LXL04_009080 | RubberDandelionOmics

Gene overview

LXL04_009080

Reference: OH-1004 Chr: Chr02 Coordinates: 117519389-117523325 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1827 bp · LXL04_009080|LXL04_009080|OH1004|cDNA

ATGCGAGTATGCGACTCACTTCTTCAAACTCAACCCCACTTGCTTCTCCCTTCTTCACTCGAGTCCCAATCCATTGAATACACCGAAAATATCAAAGATTTCTTCGCCGGAATCATGGACTCCGGTAAGAACATTAACCTATCCAGCAAAAGAAAAAAACTCCTCTTATCTACTTTCGCAGCAATCCTACTAGTCTCGGCTCTAATTGGCATTGTCGCCGGAGTAAAATCTCGCAAATCCAACACAGAAAACCTCACCAT...

CDS

Download CDS FASTA

1827 bp · LXL04_009080|LXL04_009080|OH1004|CDS

ATGCGAGTATGCGACTCACTTCTTCAAACTCAACCCCACTTGCTTCTCCCTTCTTCACTCGAGTCCCAATCCATTGAATACACCGAAAATATCAAAGATTTCTTCGCCGGAATCATGGACTCCGGTAAGAACATTAACCTATCCAGCAAAAGAAAAAAACTCCTCTTATCTACTTTCGCAGCAATCCTACTAGTCTCGGCTCTAATTGGCATTGTCGCCGGAGTAAAATCTCGCAAATCCAACACAGAAAACCTCACCAT...

Protein

Download Protein FASTA

608 aa · LXL04_009080|LXL04_009080|OH1004|PROTEIN

MRVCDSLLQTQPHLLLPSSLESQSIEYTENIKDFFAGIMDSGKNINLSSKRKKLLLSTFAAILLVSALIGIVAGVKSRKSNTENLTISAAHAVVKSSCSATLYPELCYSTITTHPDMTKKVKTQKDVIELAVNITTTAVEHSYFQIKKLTTRKSLTHRQMTALHDCLEMVSETLDDLHDVIKDLEQYQTKKSLRQHADDLKTLMSSAITNQETCLDGFSHDDEDKKVRKQLEKGERRVEKMCSNALAMICNMTNTDLANE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009080`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009080

Location Chr02:117519389-117523325 (+)

Description Similar to PMEU1: Pectinesterase/pectinesterase inhibitor U1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14310`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	Pectin methylesterase is induced in Arabidopsis upon infection and is necessary for a successful colonization by necrotrophic pathogens.2011 · DOI: 10.1094/mpmi-07-10-0157 A mutation in the Arabidopsis thaliana cell wall biosynthesis gene pectin methylesterase 3 as well as its aberrant expression cause hypersensitivity specifically to Zn.2013 · DOI: 10.1111/tpj.12279 Tuning of Pectin Methylesterification: PECTIN METHYLESTERASE INHIBITOR 7 MODULATES THE PROCESSIVE ACTIVITY OF CO-EXPRESSED PECTIN METHYLESTERASE 3 IN A pH-DEPENDENT MANNER.2015 · DOI: 10.1074/jbc.m115.639534 AtPME3, a ubiquitous cell wall pectin methylesterase of Arabidopsis thaliana, alters the metabolism of cruciferin seed storage proteins during post-germinative growth of seedlings.2017 · DOI: 10.1093/jxb/erx023
`At1g53830`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009080 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0009620 response to fungus Biological Process

GO:0009624 response to nematode Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0010187 negative regulation of seed germination Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0042545 cell wall modification Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0048364 root development Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

KEGG gene cross-reference

ath:AT1G53830

ath:AT3G14310

cit:102578056

sly:544016

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.378

Rank 1 · LXL04_009080 · OH-1004

Cell membrane0.319

Rank 2 · LXL04_009080 · OH-1004

Cytoplasm0.136

Rank 3 · LXL04_009080 · OH-1004

Endoplasmic reticulum0.115

Rank 4 · LXL04_009080 · OH-1004

Lysosome / Vacuole0.113

Rank 5 · LXL04_009080 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043.21PMEI93-248 aa

PF01095.26Pectinesterase297-593 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009080	`PF04043.21`	PMEI	93	248	7.7e-36	124.3
LXL04_009080	`PF01095.26`	Pectinesterase	297	593	1.9e-143	477.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49006`	Arabidopsis thaliana	Pectinesterase/pectinesterase inhibitor 3	66.267%	Swiss-Prot	strong database homology
`Q42534`	Arabidopsis thaliana	Pectinesterase 2	65.884%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card