LXL04_009048 | RubberDandelionOmics

Gene overview

LXL04_009048

Reference: OH-1004 Chr: Chr02 Coordinates: 116929540-116935190 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3120 bp · LXL04_009048|LXL04_009048|OH1004|cDNA

ATGAAATCCGACACTCCTCTTGATTATGCAGCATTCCATCTCTCACCAAAACGATCAAAATGTGAACTATATGTTTCTAGTGGTGGAACCACCGAAAAGATTGCATCAGGTTCAGTGAAGCCATTTGTGACTCACTTGAAGGTCGCTGAAGAACAAGTTGCATTATCATCGCAATTTATTAAACTTGAAGTTGATAGTCATAAAAATGGTGAAAAATGGTTCACAAAAGGAACATTAGAGAGATTTGTACGTTTTGTTAG...

CDS

Download CDS FASTA

3120 bp · LXL04_009048|LXL04_009048|OH1004|CDS

ATGAAATCCGACACTCCTCTTGATTATGCAGCATTCCATCTCTCACCAAAACGATCAAAATGTGAACTATATGTTTCTAGTGGTGGAACCACCGAAAAGATTGCATCAGGTTCAGTGAAGCCATTTGTGACTCACTTGAAGGTCGCTGAAGAACAAGTTGCATTATCATCGCAATTTATTAAACTTGAAGTTGATAGTCATAAAAATGGTGAAAAATGGTTCACAAAAGGAACATTAGAGAGATTTGTACGTTTTGTTAG...

Protein

Download Protein FASTA

1039 aa · LXL04_009048|LXL04_009048|OH1004|PROTEIN

MKSDTPLDYAAFHLSPKRSKCELYVSSGGTTEKIASGSVKPFVTHLKVAEEQVALSSQFIKLEVDSHKNGEKWFTKGTLERFVRFVSTPEVLELVSTFDTEWSQLESARKIYSQGSILTTGVDATKKELLRAIDVRLASVKQDLATACGRAGAAGFDHDSVVDLLLFAKRFGATRLNEACSQYISLYDRRPELFNSPSWKSQSDVGDQAIRSSHISEMSLEDESPAEQSSSTTTQPSKLLSSSATFPARGGGAHKTLDSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009048`
TK1151 ID	TkA03G395090
OH-1004 ID	LXL04_009048
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009048

Location Chr02:116929540-116935190 (-)

Description Similar to CIP7: COP1-interacting protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27430`	Exhibits transcriptional activation activity.	Role of a COP1 interactive protein in mediating light-regulated gene expression in arabidopsis.1998 · DOI: 10.1105/tpc.10.7.1083

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009048 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT4G27430

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · LXL04_009048 · OH-1004

Cell membrane0.344

Rank 2 · LXL04_009048 · OH-1004

Nucleus0.321

Rank 3 · LXL04_009048 · OH-1004

Endoplasmic reticulum0.051

Rank 4 · LXL04_009048 · OH-1004

Golgi apparatus0.044

Rank 5 · LXL04_009048 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30469.1CIP7_N9-65 aa

PF30468.1CIP7_M124-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009048	`PF30469.1`	CIP7_N	9	65	1.2e-22	80.6
LXL04_009048	`PF30468.1`	CIP7_M	124	192	1.9e-14	54.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80386`	Arabidopsis thaliana	COP1-interacting protein 7	38.636%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card