LXL04_008976 | RubberDandelionOmics

Gene overview

LXL04_008976

Reference: OH-1004 Chr: Chr02 Coordinates: 114715066-114716344 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1134 bp · LXL04_008976|LXL04_008976|OH1004|cDNA

ATGGAATCATGCCAACCAAATGGAGGACTAAAACACTACCCTTTAACCCCTCTAAGATTCTTACGCGGTCTAGCATGCCTAATCGTCTACCTGTCAACCGCCTTCATGTGTTTAGTCTATTTTACCCCTCCCTTTGCAGTTTTCCTACGCCTTTTCAGCATCCATTATAGCAGGAAAGTGTCATCTTACTTTTTTGGCATGTGGTTAGCACTCTGGCCGTTTCTCTTCGAAAAAATCAACAAAACAAAAGTGATATTTTC...

CDS

Download CDS FASTA

1134 bp · LXL04_008976|LXL04_008976|OH1004|CDS

ATGGAATCATGCCAACCAAATGGAGGACTAAAACACTACCCTTTAACCCCTCTAAGATTCTTACGCGGTCTAGCATGCCTAATCGTCTACCTGTCAACCGCCTTCATGTGTTTAGTCTATTTTACCCCTCCCTTTGCAGTTTTCCTACGCCTTTTCAGCATCCATTATAGCAGGAAAGTGTCATCTTACTTTTTTGGCATGTGGTTAGCACTCTGGCCGTTTCTCTTCGAAAAAATCAACAAAACAAAAGTGATATTTTC...

Protein

Download Protein FASTA

377 aa · LXL04_008976|LXL04_008976|OH1004|PROTEIN

MESCQPNGGLKHYPLTPLRFLRGLACLIVYLSTAFMCLVYFTPPFAVFLRLFSIHYSRKVSSYFFGMWLALWPFLFEKINKTKVIFSGEIVPEKERVLLIANHRTEVDWMYLWDLALRKGCINCIKYVLKSSLMKLPIFGWAFHVFEFISVERKWEVDESIMRKMLATFTDTSDPLWLAVFPEGTDFTEQKSINGQRFAVDNGLPVFKNVLLPKTRGFHACVEILRGSIDAVYDITIAYKNRCPTFTDNVFGVEPSEVHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008976`
TK1151 ID	TkA03G301440
OH-1004 ID	LXL04_008976
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008976

Location Chr02:114715066-114716344 (-)

Description Similar to LPAT4: Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75020`	May convert lysophosphatidic acid (LPA) into phosphatidic acid by incorporating acyl moiety at the 2 position (By similarity).	No verified direct reference in this release
`At3g18850`	May convert lysophosphatidic acid (LPA) into phosphatidic acid by incorporating acyl moiety at the 2 position (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008976 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016024 CDP-diacylglycerol biosynthetic process Biological Process

GO:0035965 cardiolipin acyl-chain remodeling Biological Process

GO:0036149 phosphatidylinositol acyl-chain remodeling Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0016020 membrane Cellular Component

GO:0003841 1-acylglycerol-3-phosphate O-acyltransferase activity Molecular Function

GO:0016746 acyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G75020

ath:AT3G18850

gga:421303

mmu:225010

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.691

Rank 1 · LXL04_008976 · OH-1004

Mitochondrion0.116

Rank 2 · LXL04_008976 · OH-1004

Cytoplasm0.114

Rank 3 · LXL04_008976 · OH-1004

Nucleus0.110

Rank 4 · LXL04_008976 · OH-1004

Cell membrane0.078

Rank 5 · LXL04_008976 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01553.27Acyltransferase84-208 aa

PF16076.11Acyltransf_C252-318 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008976	`PF01553.27`	Acyltransferase	84	208	3.5e-17	63.2
LXL04_008976	`PF16076.11`	Acyltransf_C	252	318	1e-16	61.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L4Y2`	Arabidopsis thaliana	Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase 4	62.500%	Swiss-Prot	strong database homology
`Q9LHN4`	Arabidopsis thaliana	Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase 5	63.818%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card