LXL04_008933 | RubberDandelionOmics

Gene overview

LXL04_008933

Reference: OH-1004 Chr: Chr02 Coordinates: 113112357-113124751 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6360 bp · LXL04_008933|LXL04_008933|OH1004|cDNA

atgCGCAAAAAACGCTCTCTAGGAAGACCCACCGGAGGGGGCACCTCCGGTCACCGGAACACTACCAATCACTTCCCTAGTGGCTGGAACTGGCAAAATCAAAAGGAGGAATATCTTAAGGCGAACAACAACGGTCAAAGCAGATGGAAGTTCACAGAAACTACTTCATTCTTCATTTCAAATTTACCGATCGACTGGGAAGTCCCTCAAATGCCTAGGGTTCTCGAAAAATTAGGCACTCTGATAGACTTGTTCGTGGT...

CDS

Download CDS FASTA

6360 bp · LXL04_008933|LXL04_008933|OH1004|CDS

ATGCGCAAAAAACGCTCTCTAGGAAGACCCACCGGAGGGGGCACCTCCGGTCACCGGAACACTACCAATCACTTCCCTAGTGGCTGGAACTGGCAAAATCAAAAGGAGGAATATCTTAAGGCGAACAACAACGGTCAAAGCAGATGGAAGTTCACAGAAACTACTTCATTCTTCATTTCAAATTTACCGATCGACTGGGAAGTCCCTCAAATGCCTAGGGTTCTCGAAAAATTAGGCACTCTGATAGACTTGTTCGTGGT...

Protein

Download Protein FASTA

2119 aa · LXL04_008933|LXL04_008933|OH1004|PROTEIN

MRKKRSLGRPTGGGTSGHRNTTNHFPSGWNWQNQKEEYLKANNNGQSRWKFTETTSFFISNLPIDWEVPQMPRVLEKLGTLIDLFVVGWKDKYGNRFGFARYNRVEDTAEMVNKIKRTTMGRNKIYAREAKFERKAKGKIPSSTAKNQHGKGKAGYHPTLNQNKVSPNLSFKDVCKGSQNPIIKTKINDSHNMESIRETFQTFDITNGGNRKEELTSKLVGELIHYKAVSHISTVIAGEGYPDDIIDYLGDFWILLSPRT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008933`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008933

Location Chr02:113112357-113124751 (+)

Description Similar to RBK1: Receptor-like cytosolic serine/threonine-protein kinase RBK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g16750`	Promotes cell proliferation in the gibberellic acid (GA) signaling pathway, acting downstream of RGA, and possibly through a negative regulation of two cyclin-dependent kinase inhibitors SIM and SMR1.	No verified direct reference in this release
`At5g10520`	Receptor-like cytosolic serine/threonine-protein kinase RBK1.	No verified direct reference in this release
`At1g10620`	Putative proline-rich receptor-like protein kinase PERK11.	No verified direct reference in this release
`At3g05140`	Receptor-like cytosolic serine/threonine-protein kinase RBK2.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008933 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0010476 gibberellin mediated signaling pathway Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051781 positive regulation of cell division Biological Process

GO:0071369 cellular response to ethylene stimulus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G10620

ath:AT2G16750

ath:AT3G05140

ath:AT5G10520

ath:AT5G38560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.516

Rank 1 · LXL04_008933 · OH-1004

Nucleus0.324

Rank 2 · LXL04_008933 · OH-1004

Cell membrane0.194

Rank 3 · LXL04_008933 · OH-1004

Endoplasmic reticulum0.041

Rank 4 · LXL04_008933 · OH-1004

Plastid0.036

Rank 5 · LXL04_008933 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03372.30Exo_endo_phos572-793 aa

PF14529.13Exo_endo_phos_2673-796 aa

PF00078.33RVT_1990-1164 aa

PF13966.12zf-RVT1444-1520 aa

PF07714.24PK_Tyr_Ser-Thr1918-2098 aa

PF00069.32Pkinase1919-2097 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008933	`PF03372.30`	Exo_endo_phos	572	793	1.4e-11	45.2
LXL04_008933	`PF14529.13`	Exo_endo_phos_2	673	796	2.4e-07	31.3
LXL04_008933	`PF00078.33`	RVT_1	990	1164	8.1e-14	52.7
LXL04_008933	`PF13966.12`	zf-RVT	1444	1520	5.3e-15	56.6
LXL04_008933	`PF07714.24`	PK_Tyr_Ser-Thr	1918	2098	2.1e-16	60.8
LXL04_008933	`PF00069.32`	Pkinase	1919	2097	8.6e-22	78.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B5X4Z9`	Arabidopsis thaliana	Protein kinase STUNTED	39.252%	Swiss-Prot	weak database homology
`Q8H1D6`	Arabidopsis thaliana	Receptor-like cytosolic serine/threonine-protein kinase RBK1	42.391%	Swiss-Prot	weak database homology
`Q9SGY7`	Arabidopsis thaliana	Putative proline-rich receptor-like protein kinase PERK11	44.149%	Swiss-Prot	weak database homology
`Q8RXC8`	Arabidopsis thaliana	Receptor-like cytosolic serine/threonine-protein kinase RBK2	44.022%	Swiss-Prot	weak database homology
`Q9FFW5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK8	41.398%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card