LXL04_008929 | RubberDandelionOmics

Gene overview

LXL04_008929

Reference: OH-1004 Chr: Chr02 Coordinates: 112861459-112865447 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2370 bp · LXL04_008929|LXL04_008929|OH1004|cDNA

ATGGACACAGAAGATCGTTCACCAACCGACCCACGATGCACCCAAGTAACGGTCATGAAAGTGGCCAATATTGCGCTCAATATGTTGATATTCATCATCACGTTGGCTTTGTGCAGCATATTGCACATGCTCTTACGTCCGTACTCCCAACCTCGTATCATTTCTGAAGCCATTGTGGGATTCTTTTTGAGTAACCTACCGTTTCTACGTAACAACTTCAACGATGATGCAAATACTGCGCTCGGTTATGTCGCAGAGTT...

CDS

Download CDS FASTA

2370 bp · LXL04_008929|LXL04_008929|OH1004|CDS

ATGGACACAGAAGATCGTTCACCAACCGACCCACGATGCACCCAAGTAACGGTCATGAAAGTGGCCAATATTGCGCTCAATATGTTGATATTCATCATCACGTTGGCTTTGTGCAGCATATTGCACATGCTCTTACGTCCGTACTCCCAACCTCGTATCATTTCTGAAGCCATTGTGGGATTCTTTTTGAGTAACCTACCGTTTCTACGTAACAACTTCAACGATGATGCAAATACTGCGCTCGGTTATGTCGCAGAGTT...

Protein

Download Protein FASTA

789 aa · LXL04_008929|LXL04_008929|OH1004|PROTEIN

MDTEDRSPTDPRCTQVTVMKVANIALNMLIFIITLALCSILHMLLRPYSQPRIISEAIVGFFLSNLPFLRNNFNDDANTALGYVAEFGMICHMFVIGLEIDPNIFIRVPIREAKMACTGLLLTFLLSLFVTPMLHLSYEPNFAFDVTISLVLSGTASPLLRRIINDLKIGKSDIGRFLISTAVISDLISILVLTLGYIVFDPLDGFAIRRVSEILLMLAVLVIQTILAAKCIPFLMRWVDTHNPQGKLMKGPHLIVSIAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008929`
TK1151 ID	TkA03G309490
OH-1004 ID	LXL04_008929
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008929

Location Chr02:112861459-112865447 (+)

Description Similar to CHX28: Cation/H(+) antiporter 28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52080`	May operate as a cation/H(+) antiporter.	No verified direct reference in this release
`At2g13620`	May operate as a cation/H(+) antiporter.	No verified direct reference in this release
`At5g41610`	May operate as a cation/H(+) antiporter.	No verified direct reference in this release
`At3g17630`	May operate as a cation/H(+) antiporter.	No verified direct reference in this release
`At1g05580`	Operates as a K(+)/H(+) antiporter or Na(+)/H(+) antiporter of the chloroplast envelope that functions in pH homeostasis and chloroplast development.	A probable Na+(K+)/H+ exchanger on the chloroplast envelope functions in pH homeostasis and chloroplast development in Arabidopsis thaliana.2004 · DOI: 10.1073/pnas.0403709101 Pollen tubes lacking a pair of K+ transporters fail to target ovules in Arabidopsis.2011 · DOI: 10.1105/tpc.110.080499

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008929 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006813 potassium ion transport Biological Process

GO:0006885 regulation of pH Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0071805 potassium ion transmembrane transport Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005770 late endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G05580

ath:AT2G13620

ath:AT3G17630

ath:AT3G52080

ath:AT5G41610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.631

Rank 1 · LXL04_008929 · OH-1004

Endoplasmic reticulum0.147

Rank 2 · LXL04_008929 · OH-1004

Lysosome / Vacuole0.142

Rank 3 · LXL04_008929 · OH-1004

Cytoplasm0.084

Rank 4 · LXL04_008929 · OH-1004

Golgi apparatus0.058

Rank 5 · LXL04_008929 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00999.27Na_H_Exchanger34-419 aa

PF23256.2CHX17_2nd475-602 aa

PF23259.2CHX17_C616-771 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008929	`PF00999.27`	Na_H_Exchanger	34	419	4.8e-31	108.7
LXL04_008929	`PF23256.2`	CHX17_2nd	475	602	4.2e-34	118.1
LXL04_008929	`PF23259.2`	CHX17_C	616	771	1.7e-37	129.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L709`	Arabidopsis thaliana	Cation/H(+) antiporter 28	44.744%	Swiss-Prot	moderate database homology
`Q9SIT5`	Arabidopsis thaliana	Cation/H(+) antiporter 15	30.504%	Swiss-Prot	moderate database homology
`Q9FFR9`	Arabidopsis thaliana	Cation/H(+) antiporter 18	29.510%	Swiss-Prot	weak database homology
`Q9LUN4`	Arabidopsis thaliana	Cation/H(+) antiporter 19	29.193%	Swiss-Prot	weak database homology
`Q8VYD4`	Arabidopsis thaliana	Cation/H(+) antiporter 23, chloroplastic	26.868%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card