LXL04_008926 | RubberDandelionOmics

Gene overview

LXL04_008926

Reference: OH-1004 Chr: Chr02 Coordinates: 112643797-112646805 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2568 bp · LXL04_008926|LXL04_008926|OH1004|cDNA

ATGGAGGCTATGCTCAAGGTATTATTTTATCTCTTTTTCATCTTGCTGTTGCTGGTTAACTCGGTGTTGACCCAGTCCACGGTGCGGCCACTGAGTTCCGGTGTGGAAAGAACAGCGCTGTTCGATCTTCGAGCTTCTTTAGGAATAAAAGCCAGATACTGGCCGAGGAAAGTAGACCCGTGTGCCAACTGGACAGGGGTGGAGTGCGGGAACGGCCGAGTCACCGGAATAAATTTGTCCGGTTTACGACGAACTCGTGT...

CDS

Download CDS FASTA

2568 bp · LXL04_008926|LXL04_008926|OH1004|CDS

ATGGAGGCTATGCTCAAGGTATTATTTTATCTCTTTTTCATCTTGCTGTTGCTGGTTAACTCGGTGTTGACCCAGTCCACGGTGCGGCCACTGAGTTCCGGTGTGGAAAGAACAGCGCTGTTCGATCTTCGAGCTTCTTTAGGAATAAAAGCCAGATACTGGCCGAGGAAAGTAGACCCGTGTGCCAACTGGACAGGGGTGGAGTGCGGGAACGGCCGAGTCACCGGAATAAATTTGTCCGGTTTACGACGAACTCGTGT...

Protein

Download Protein FASTA

855 aa · LXL04_008926|LXL04_008926|OH1004|PROTEIN

MEAMLKVLFYLFFILLLLVNSVLTQSTVRPLSSGVERTALFDLRASLGIKARYWPRKVDPCANWTGVECGNGRVTGINLSGLRRTRVGSLSPSFSIDSLVRCTQLSTFNASGFALPGRIPDWLGQNLRALQVLDLTSSSIVGPIPPSIGSLNQLTLLLLADNSLTGNIPDSLRQLSSLSVLNLSLNMLTGSIPSSFSSLTNLTTLDFSSNFLSGPIPPTFGSFSGLQFLNLSNNSLASSIPVQLGNLSQLLDLDLGFNSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008926`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008926

Location Chr02:112643797-112646805 (+)

Description Similar to At2g16250: Probable LRR receptor-like serine/threonine-protein kinase At2g16250

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g16250`	Probable LRR receptor-like serine/threonine-protein kinase At2g16250.	No verified direct reference in this release
`At1g55610`	Receptor with a serine/threonine-protein kinase activity.	BRL1, a leucine-rich repeat receptor-like protein kinase, is functionally redundant with BRI1 in regulating Arabidopsis brassinosteroid signaling.2004 · DOI: 10.1111/j.1365-313x.2004.02214.x BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis.2004 · DOI: 10.1242/dev.01403
`At3g13380`	Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis.2004 · DOI: 10.1242/dev.01403
`At4g20140`	Together with GSO2, receptor-like serine/threonine-kinase required during the development of the epidermal surface in embryos and cotyledons.	GASSHO1 and GASSHO2 encoding a putative leucine-rich repeat transmembrane-type receptor kinase are essential for the normal development of the epidermal surface in Arabidopsis embryos.2008 · DOI: 10.1111/j.1365-313x.2007.03395.x The receptor-like kinases GSO1 and GSO2 together regulate root growth in Arabidopsis through control of cell division and cell fate specification.2014 · DOI: 10.1002/dvdy.24066 A peptide hormone required for Casparian strip diffusion barrier formation in Arabidopsis roots.2017 · DOI: 10.1126/science.aai9057

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0130100`	Receptor kinase involved in salt drought stress responses.	Receptor-like kinase OsSIK1 improves drought and salt stress tolerance in rice (Oryza sativa) plants.2010 · DOI: 10.1111/j.1365-313x.2010.04146.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008926 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009729 detection of brassinosteroid stimulus Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005496 steroid binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G55610

ath:AT2G16250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.817

Rank 1 · LXL04_008926 · OH-1004

Endoplasmic reticulum0.083

Rank 2 · LXL04_008926 · OH-1004

Cytoplasm0.069

Rank 3 · LXL04_008926 · OH-1004

Nucleus0.056

Rank 4 · LXL04_008926 · OH-1004

Lysosome / Vacuole0.038

Rank 5 · LXL04_008926 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23598.2LRR_14120-183 aa

PF13855.13LRR_8129-188 aa

PF13855.13LRR_8153-210 aa

PF13855.13LRR_8177-236 aa

PF23598.2LRR_14190-292 aa

PF13855.13LRR_8225-284 aa

PF07714.24PK_Tyr_Ser-Thr493-765 aa

PF00069.32Pkinase495-763 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008926	`PF23598.2`	LRR_14	120	183	6.2e-17	62.1
LXL04_008926	`PF13855.13`	LRR_8	129	188	5.6e-13	49.1
LXL04_008926	`PF13855.13`	LRR_8	153	210	5.6e-13	49.1
LXL04_008926	`PF13855.13`	LRR_8	177	236	5.6e-13	49.1
LXL04_008926	`PF23598.2`	LRR_14	190	292	6.2e-17	62.1
LXL04_008926	`PF13855.13`	LRR_8	225	284	5.6e-13	49.1
LXL04_008926	`PF07714.24`	PK_Tyr_Ser-Thr	493	765	5.6e-21	75.7
LXL04_008926	`PF00069.32`	Pkinase	495	763	5.4e-14	52.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGK4`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At2g16250	49.634%	Swiss-Prot	moderate database homology
`Q9ZWC8`	Arabidopsis thaliana	Serine/threonine-protein kinase BRI1-like 1	29.801%	Swiss-Prot	weak database homology
`Q9LJF3`	Arabidopsis thaliana	Receptor-like protein kinase BRI1-like 3	30.251%	Swiss-Prot	moderate database homology
`C0LGQ5`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase GSO1	30.223%	Swiss-Prot	moderate database homology
`Q658G7`	Oryza sativa subsp. japonica	LRR receptor-like serine/threonine-protein kinase SIK1	30.688%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card