LXL04_008802 | RubberDandelionOmics

Gene overview

LXL04_008802

Reference: OH-1004 Chr: Chr02 Coordinates: 109263501-109266304 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1593 bp · LXL04_008802|LXL04_008802|OH1004|cDNA

ATGACATCGTCGGTGGCAGTGGAGACggagaagaaagaagaggatgtgAAGGGAGGGGAACTGTTGTTCTGTGGTACAACGTACTGGGACATAGGTGTTGACCGCCGCAAGGCGTCACCGGAAAGCAGCTTGGTTTCTCCTACTCGGCTTCAGCCTCTCGTCGGCGTCGACATCCGCTACGTTGCATCCGGCTGTGCCTCTTTTCATTGCGTGGCATTGGGTGTCGATGGACGTTGCTACACATGGGGTCGAAATGAGGC...

CDS

Download CDS FASTA

1593 bp · LXL04_008802|LXL04_008802|OH1004|CDS

ATGACATCGTCGGTGGCAGTGGAGACGGAGAAGAAAGAAGAGGATGTGAAGGGAGGGGAACTGTTGTTCTGTGGTACAACGTACTGGGACATAGGTGTTGACCGCCGCAAGGCGTCACCGGAAAGCAGCTTGGTTTCTCCTACTCGGCTTCAGCCTCTCGTCGGCGTCGACATCCGCTACGTTGCATCCGGCTGTGCCTCTTTTCATTGCGTGGCATTGGGTGTCGATGGACGTTGCTACACATGGGGTCGAAATGAGGC...

Protein

Download Protein FASTA

530 aa · LXL04_008802|LXL04_008802|OH1004|PROTEIN

MTSSVAVETEKKEEDVKGGELLFCGTTYWDIGVDRRKASPESSLVSPTRLQPLVGVDIRYVASGCASFHCVALGVDGRCYTWGRNEASLRHFPSHNPSKVHASSLMLVVISTSELKGQLGHGDKILRGSPSVVTGLSKHKVVKAGSGGGHTVVQTEDGLSFSFGWNKHGQLGTGSTKTEFELSPVRCLLTDVKDVACGADFTVWLTSVEGSSILTAGHPQYGQLGHGTDNEYNTKDSSVKLAYEAQPRPKAIASFSEETI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008802`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008802

Location Chr02:109263501-109266304 (-)

Description Similar to RCC2: Protein RCC2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63860`	UV-B specific signaling component that acts as a UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants.	A UV-B-specific signaling component orchestrates plant UV protection.2005 · DOI: 10.1073/pnas.0507187102 UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B specific signaling component UVR8 and activates its function in the nucleus.2007 · DOI: 10.1105/tpc.107.053330 UV-B signaling pathways with different fluence-rate response profiles are distinguished in mature Arabidopsis leaf tissue by requirement for UVR8, HY5, and HYH.2008 · DOI: 10.1104/pp.107.108456 Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2009 · DOI: 10.1038/emboj.2009.4 UVR8 in Arabidopsis thaliana regulates multiple aspects of cellular differentiation during leaf development in response to ultraviolet B radiation.2009 · DOI: 10.1111/j.1469-8137.2009.02855.x Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2010 · DOI: 10.1073/pnas.0914532107 Functional interaction of the circadian clock and UV RESISTANCE LOCUS 8-controlled UV-B signaling pathways in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04573.x Perception of UV-B by the Arabidopsis UVR8 protein.2011 · DOI: 10.1126/science.1200660 UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation.2012 · DOI: 10.1093/mp/sss025 C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein.2012 · DOI: 10.1073/pnas.1210898109 In vivo function of tryptophans in the Arabidopsis UV-B photoreceptor UVR8.2012 · DOI: 10.1105/tpc.112.101451 The UV-B photoreceptor UVR8 promotes photosynthetic efficiency in Arabidopsis thaliana exposed to elevated levels of UV-B.2012 · DOI: 10.1007/s11120-012-9785-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008802 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007229 integrin-mediated signaling pathway Biological Process

GO:0009411 response to UV Biological Process

GO:0009649 entrainment of circadian clock Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010762 regulation of fibroblast migration Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0030334 regulation of cell migration Biological Process

GO:0034260 negative regulation of GTPase activity Biological Process

GO:0045184 establishment of protein localization Biological Process

GO:0048041 focal adhesion assembly Biological Process

GO:0051301 cell division Biological Process

GO:0051895 negative regulation of focal adhesion assembly Biological Process

KEGG gene cross-reference

ath:AT5G63860

dre:406455

hsa:55920

mmu:108911

xla:734455

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.664

Rank 1 · LXL04_008802 · OH-1004

Cytoplasm0.289

Rank 2 · LXL04_008802 · OH-1004

Cell membrane0.058

Rank 3 · LXL04_008802 · OH-1004

Mitochondrion0.045

Rank 4 · LXL04_008802 · OH-1004

Endoplasmic reticulum0.044

Rank 5 · LXL04_008802 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25390.2WD40_RLD27-186 aa

PF25384.2Alsin_RLD113-181 aa

PF25390.2WD40_RLD116-432 aa

PF00415.25RCC1116-153 aa

PF00415.25RCC1157-203 aa

PF00415.25RCC1215-272 aa

PF13540.13RCC1_2260-288 aa

PF00415.25RCC1276-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008802	`PF25390.2`	WD40_RLD	27	186	1.4e-69	235.9
LXL04_008802	`PF25384.2`	Alsin_RLD	113	181	1.6e-14	54.6
LXL04_008802	`PF25390.2`	WD40_RLD	116	432	1.4e-69	235.9
LXL04_008802	`PF00415.25`	RCC1	116	153	2.5e-52	175.9
LXL04_008802	`PF00415.25`	RCC1	157	203	2.5e-52	175.9
LXL04_008802	`PF00415.25`	RCC1	215	272	2.5e-52	175.9
LXL04_008802	`PF13540.13`	RCC1_2	260	288	4.2e-20	71.6
LXL04_008802	`PF00415.25`	RCC1	276	311	2.5e-52	175.9
LXL04_008802	`PF00415.25`	RCC1	382	428	2.5e-52	175.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN03`	Arabidopsis thaliana	Ultraviolet-B receptor UVR8	30.887%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card