LXL04_008451 | RubberDandelionOmics

Gene overview

LXL04_008451

Reference: OH-1004 Chr: Chr02 Coordinates: 99939067-99944107 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2877 bp · LXL04_008451|LXL04_008451|OH1004|cDNA

ATGGAGACAAAAGGCGTCTCACTTGGTGAGCGATCCCCATTCATTTATCCGGTAGATTGTTTAATGGAGAGGCGTTCGGGGTTTATCGGATGGCTAAACCCCCTTTCTAGGGCTCCGGCAATGAACACTATGCCCCAATTTACAACAAACCTTCGCCTCCTTTTCTCCACCGCTGCCAACCACCCTTCCCCCTCTTTCTTCCTCTCTAATCCACTCCTCAAATATAACAACAAACTCCCCACTAAACACCATAACTCCCA...

CDS

Download CDS FASTA

2877 bp · LXL04_008451|LXL04_008451|OH1004|CDS

ATGGAGACAAAAGGCGTCTCACTTGGTGAGCGATCCCCATTCATTTATCCGGTAGATTGTTTAATGGAGAGGCGTTCGGGGTTTATCGGATGGCTAAACCCCCTTTCTAGGGCTCCGGCAATGAACACTATGCCCCAATTTACAACAAACCTTCGCCTCCTTTTCTCCACCGCTGCCAACCACCCTTCCCCCTCTTTCTTCCTCTCTAATCCACTCCTCAAATATAACAACAAACTCCCCACTAAACACCATAACTCCCA...

Protein

Download Protein FASTA

958 aa · LXL04_008451|LXL04_008451|OH1004|PROTEIN

METKGVSLGERSPFIYPVDCLMERRSGFIGWLNPLSRAPAMNTMPQFTTNLRLLFSTAANHPSPSFFLSNPLLKYNNKLPTKHHNSHPFFTCLSSSRKPPRHTSKSSNPNRRINTSSVKQSVNKDKSESSSMKMDVEVEDPKKIGMHAAGFNKRRAEGRDKSIRPKDLNLKVRRLNSNTISYVQILGTGMDTQDTSPSVLLFFDRQRFIFNAGEGLQRFCTEHKIKLSKIDHIFLSRVCSETAGGLPGLLLTLAGTGEEG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008451`
TK1151 ID	TkA03G371400
OH-1004 ID	LXL04_008451
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.500
Protein coverage (%)	TK1151 93.190 / OH-1004 54.175 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008451

Location Chr02:99939067-99944107 (-)

Description Similar to TRZ4: tRNAse Z TRZ4, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16260`	Zinc phosphodiesterase, which displays tRNA 3'-processing endonuclease activity.	No verified direct reference in this release
`At1g52160`	Zinc phosphodiesterase, which displays tRNA 3'-processing endonuclease activity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008451 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016078 tRNA decay Biological Process

GO:0042780 tRNA 3'-end processing Biological Process

GO:0090646 mitochondrial tRNA processing Biological Process

GO:1990180 mitochondrial tRNA 3'-end processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0042645 mitochondrial nucleoid Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0004521 RNA endonuclease activity Molecular Function

KEGG gene cross-reference

ath:AT1G52160

ath:AT3G16260

hsa:60528

ptr:450109

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.576

Rank 1 · LXL04_008451 · OH-1004

Mitochondrion0.292

Rank 2 · LXL04_008451 · OH-1004

Nucleus0.119

Rank 3 · LXL04_008451 · OH-1004

Cytoplasm0.065

Rank 4 · LXL04_008451 · OH-1004

Peroxisome0.022

Rank 5 · LXL04_008451 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13691.13Lactamase_B_4189-245 aa

PF23023.2Anti-Pycsar_Apyc1616-695 aa

PF12706.14Lactamase_B_2646-733 aa

PF12706.14Lactamase_B_2816-890 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008451	`PF13691.13`	Lactamase_B_4	189	245	2.3e-18	66.3
LXL04_008451	`PF23023.2`	Anti-Pycsar_Apyc1	616	695	4.4e-14	53.5
LXL04_008451	`PF12706.14`	Lactamase_B_2	646	733	4.5e-12	46.7
LXL04_008451	`PF12706.14`	Lactamase_B_2	816	890	4.5e-12	46.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J1H7`	Arabidopsis thaliana	tRNAse Z TRZ4, mitochondrial	61.659%	Swiss-Prot	strong database homology
`Q8VYS2`	Arabidopsis thaliana	tRNase Z TRZ3, mitochondrial	63.017%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card