LXL04_008394 | RubberDandelionOmics

Gene overview

LXL04_008394

Reference: OH-1004 Chr: Chr02 Coordinates: 98352643-98354357 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

777 bp · LXL04_008394|LXL04_008394|OH1004|cDNA

ATGGAAAGTGGGTATTCGAGGGTGGATGTTCAAGAGATACATCCGCAACTGTTGGATTTGATTCCGAAAGAGAGAAACTGGTTTGTGAAAAGAGGCGATGATCATGATCATATCGAAGGTCGATCAAGAAGAAGCCATGGAAATGGAGATGAAAACACGCTTGAGCTACGACTTGGTCCACCTTGTGTTGAAGATTGGTCACCAAGAAGCTACAAATCGGTAACAAAAGCATCTGTTCCTGTCCCCAATACCTCTCAAAA...

CDS

Download CDS FASTA

777 bp · LXL04_008394|LXL04_008394|OH1004|CDS

ATGGAAAGTGGGTATTCGAGGGTGGATGTTCAAGAGATACATCCGCAACTGTTGGATTTGATTCCGAAAGAGAGAAACTGGTTTGTGAAAAGAGGCGATGATCATGATCATATCGAAGGTCGATCAAGAAGAAGCCATGGAAATGGAGATGAAAACACGCTTGAGCTACGACTTGGTCCACCTTGTGTTGAAGATTGGTCACCAAGAAGCTACAAATCGGTAACAAAAGCATCTGTTCCTGTCCCCAATACCTCTCAAAA...

Protein

Download Protein FASTA

258 aa · LXL04_008394|LXL04_008394|OH1004|PROTEIN

MESGYSRVDVQEIHPQLLDLIPKERNWFVKRGDDHDHIEGRSRRSHGNGDENTLELRLGPPCVEDWSPRSYKSVTKASVPVPNTSQKRSAPAPVVGWPPIRSFRKNIATSSSKAAPPSDSENVVVSDNDVKREKKMESCQKGFFVKINMNGVPIGRKVDLNAYDSYQKLSTAVDELFRGLLAAQKDTSGNQEQEKAITGLLDGSGEYTLVYEDNEGDRMLVGDVPWHMFVSTVKRLRVIKSSEISNICLGSKQAKIQL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008394`
TK1151 ID	TkA03G377350
OH-1004 ID	LXL04_008394
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008394

Location Chr02:98352643-98354357 (+)

Description Similar to IAA26: Auxin-responsive protein IAA26

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16500`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At1g51950`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0228900`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`Os05g0523300`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`Os01g0741900`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008394 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006417 regulation of translation Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT1G51950

ath:AT3G16500

dosa:Os01g0741900

dosa:Os02g0228900

dosa:Os05g0523300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.910

Rank 1 · LXL04_008394 · OH-1004

Cytoplasm0.152

Rank 2 · LXL04_008394 · OH-1004

Cell membrane0.058

Rank 3 · LXL04_008394 · OH-1004

Endoplasmic reticulum0.029

Rank 4 · LXL04_008394 · OH-1004

Plastid0.015

Rank 5 · LXL04_008394 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02309.23AUX_IAA78-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008394	`PF02309.23`	AUX_IAA	78	246	5e-62	210.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LAL2`	Arabidopsis thaliana	Auxin-responsive protein IAA26	51.460%	Swiss-Prot	strong database homology
`O24408`	Arabidopsis thaliana	Auxin-responsive protein IAA18	52.708%	Swiss-Prot	strong database homology
`Q6H543`	Oryza sativa subsp. japonica	Auxin-responsive protein IAA7	59.036%	Swiss-Prot	moderate database homology
`Q5W670`	Oryza sativa subsp. japonica	Auxin-responsive protein IAA18	53.368%	Swiss-Prot	moderate database homology
`Q8LQ74`	Oryza sativa subsp. japonica	Auxin-responsive protein IAA6	56.977%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card