LXL04_008306 | RubberDandelionOmics

Gene overview

LXL04_008306

Reference: OH-1004 Chr: Chr02 Coordinates: 96231814-96234553 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1968 bp · LXL04_008306|LXL04_008306|OH1004|cDNA

ATGAGTAAAGAAAGGTGCATGGAAAAACACGAGGACTCAAAAATCGTTGAAACAGTCGTAGTTGCCGTTAAAGCATCAAGGGAAATTCCAAAGTCAGCTTTGGTTTGGGCTTTGACTCATGTAGTCCAACCAGGGCATTGCATTACACTACTTGTTGTCATCCCTTCTGGTAAAAGATTATGGGGTCTTCCGAGATTTACTGGAGATTGTGCTAGTCGTCATTGGAGATCTTATTTAGGAAAAAGTGATATCGCGGATTc...

CDS

Download CDS FASTA

1968 bp · LXL04_008306|LXL04_008306|OH1004|CDS

ATGAGTAAAGAAAGGTGCATGGAAAAACACGAGGACTCAAAAATCGTTGAAACAGTCGTAGTTGCCGTTAAAGCATCAAGGGAAATTCCAAAGTCAGCTTTGGTTTGGGCTTTGACTCATGTAGTCCAACCAGGGCATTGCATTACACTACTTGTTGTCATCCCTTCTGGTAAAAGATTATGGGGTCTTCCGAGATTTACTGGAGATTGTGCTAGTCGTCATTGGAGATCTTATTTAGGAAAAAGTGATATCGCGGATTC...

Protein

Download Protein FASTA

655 aa · LXL04_008306|LXL04_008306|OH1004|PROTEIN

MSKERCMEKHEDSKIVETVVVAVKASREIPKSALVWALTHVVQPGHCITLLVVIPSGKRLWGLPRFTGDCASRHWRSYLGKSDIADSCSQMILQLHNMYDPNKINVKIKTVSGLPYGAVALEAKQIHATWVILDKKLKHEQKRCMEELQCNIVTIKKSRPKIIRLNLIGSPKNEPQITNQSSKKLQKDTKYSPQFSPEALSLTEPSTSISSSDPGASPFFIPLKSNHELAESSSDSESENLSSSFSRRFQPWMIDILTST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008306`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008306

Location Chr02:96231814-96234553 (-)

Description Similar to SELMODRAFT_444075: Inactive protein kinase SELMODRAFT_444075

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26150`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At1g23540`	Regulates the auxin-related MAX (More Axillary Growth) pathway during the shoot branching.	Over-expression of the IGI1 leading to altered shoot-branching development related to MAX pathway in Arabidopsis.2010 · DOI: 10.1007/s11103-010-9645-0
`At1g70460`	Negatively regulates root hair elongation.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008306 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0032502 developmental process Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0019901 protein kinase binding Molecular Function

KEGG gene cross-reference

ath:AT1G23540

ath:AT1G26150

ath:AT1G70460

ath:AT5G38560

smo:SELMODRAFT_444075

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.577

Rank 1 · LXL04_008306 · OH-1004

Cytoplasm0.303

Rank 2 · LXL04_008306 · OH-1004

Nucleus0.302

Rank 3 · LXL04_008306 · OH-1004

Endoplasmic reticulum0.039

Rank 4 · LXL04_008306 · OH-1004

Golgi apparatus0.029

Rank 5 · LXL04_008306 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase327-593 aa

PF07714.24PK_Tyr_Ser-Thr328-595 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008306	`PF00069.32`	Pkinase	327	593	4.3e-41	141.8
LXL04_008306	`PF07714.24`	PK_Tyr_Ser-Thr	328	595	3e-43	148.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C660`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK10	47.443%	Swiss-Prot	moderate database homology
`Q9ZUE0`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK12	49.258%	Swiss-Prot	moderate database homology
`Q9CAL8`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK13	48.864%	Swiss-Prot	moderate database homology
`Q9FFW5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK8	45.098%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card