LXL04_008210 | RubberDandelionOmics

Gene overview

LXL04_008210

Reference: OH-1004 Chr: Chr02 Coordinates: 92352411-92356495 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1644 bp · LXL04_008210|LXL04_008210|OH1004|cDNA

ATGGTGGAGAACGGACACCAACAGCCGCCAGCTCCTGCGCCGCCGCCGCCCAGCGTCCAGCAACCGCTGGGTGCCGCCAGAGGTCCTGCTTACCCACCCGCCGAACAACTTCTCCAGCTTAACTACTGCATCCATTCCAATCCTTCATGGGCCCAAACCGCTGTTCTAGCATTCCAACACTACATCGTTCTGCTTGGCAGCATAGTCATGATCGCATCCATTCTTGTACCTCAAATGGGTGGTAGTCATGGGGATAAAGC...

CDS

Download CDS FASTA

1644 bp · LXL04_008210|LXL04_008210|OH1004|CDS

ATGGTGGAGAACGGACACCAACAGCCGCCAGCTCCTGCGCCGCCGCCGCCCAGCGTCCAGCAACCGCTGGGTGCCGCCAGAGGTCCTGCTTACCCACCCGCCGAACAACTTCTCCAGCTTAACTACTGCATCCATTCCAATCCTTCATGGGCCCAAACCGCTGTTCTAGCATTCCAACACTACATCGTTCTGCTTGGCAGCATAGTCATGATCGCATCCATTCTTGTACCTCAAATGGGTGGTAGTCATGGGGATAAAGC...

Protein

Download Protein FASTA

547 aa · LXL04_008210|LXL04_008210|OH1004|PROTEIN

MVENGHQQPPAPAPPPPSVQQPLGAARGPAYPPAEQLLQLNYCIHSNPSWAQTAVLAFQHYIVLLGSIVMIASILVPQMGGSHGDKARVIQALLFMSGINTLLQALCGTRLPTVMGPSFAYMLAVLSIINDFRDEDFPSEHQRFLHTMRAIQGSLIISSFINILLGFSRAWGEFTKLLSPLIVFPYVCVVGLGLFGRGFPQLATCVELGLPMLVFLVVFQQYMKRLHLSAHSILERFALLFCIGLVWAFAAILTAAGAYN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008210`
TK1151 ID	TkA03G287520
OH-1004 ID	LXL04_008210
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008210

Location Chr02:92352411-92356495 (-)

Description Similar to NAT3: Nucleobase-ascorbate transporter 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26510`	Nucleobase-ascorbate transporter 3.	No verified direct reference in this release
`At2g34190`	Nucleobase-ascorbate transporter 2.	No verified direct reference in this release
`At2g05760`	Nucleobase-ascorbate transporter 1.	No verified direct reference in this release
`At5g62890`	Nucleobase-ascorbate transporter 6.	No verified direct reference in this release
`At1g60030`	Nucleobase-ascorbate transporter 7.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008210 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0035344 hypoxanthine transport Biological Process

GO:0098702 adenine import across plasma membrane Biological Process

GO:0098710 guanine import across plasma membrane Biological Process

GO:0098721 uracil import across plasma membrane Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G60030

ath:AT2G05760

ath:AT2G26510

ath:AT2G34190

ath:AT5G62890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.840

Rank 1 · LXL04_008210 · OH-1004

Cytoplasm0.114

Rank 2 · LXL04_008210 · OH-1004

Endoplasmic reticulum0.058

Rank 3 · LXL04_008210 · OH-1004

Lysosome / Vacuole0.050

Rank 4 · LXL04_008210 · OH-1004

Golgi apparatus0.031

Rank 5 · LXL04_008210 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00860.27Xan_ur_permease52-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008210	`PF00860.27`	Xan_ur_permease	52	456	2.4e-65	221.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZD4`	Arabidopsis thaliana	Nucleobase-ascorbate transporter 3	69.674%	Swiss-Prot	strong database homology
`Q94C70`	Arabidopsis thaliana	Nucleobase-ascorbate transporter 2	56.420%	Swiss-Prot	strong database homology
`Q9SHZ3`	Arabidopsis thaliana	Nucleobase-ascorbate transporter 1	56.311%	Swiss-Prot	strong database homology
`Q27GI3`	Arabidopsis thaliana	Nucleobase-ascorbate transporter 6	49.436%	Swiss-Prot	moderate database homology
`Q0WPE9`	Arabidopsis thaliana	Nucleobase-ascorbate transporter 7	49.806%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card