Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3528 bp · LXL04_008174|LXL04_008174|OH1004|cDNA
ATGATTCTCCATCGTATATTTATAATTAGAGCCACCGTCAGCAATCACCACCGCCGTCATGTATCAAATTTCTCTCCCAGACGCCTCTTCTCTTCTTCCCCTTCCGGTAATAACCACGAGAATTCCACCGTTACCAGGAAAAACCTCAAAAAGTTGCAAAATGCAGGTTCGCGATTACCGTTTCCCCTCCTCAACCACTTACGGCCTAATTCCCTCTCCCGCATTGCCGTTGCCGCGAGCTTGATATCCGCTGCCATTGC...
3528 bp · LXL04_008174|LXL04_008174|OH1004|CDS
ATGATTCTCCATCGTATATTTATAATTAGAGCCACCGTCAGCAATCACCACCGCCGTCATGTATCAAATTTCTCTCCCAGACGCCTCTTCTCTTCTTCCCCTTCCGGTAATAACCACGAGAATTCCACCGTTACCAGGAAAAACCTCAAAAAGTTGCAAAATGCAGGTTCGCGATTACCGTTTCCCCTCCTCAACCACTTACGGCCTAATTCCCTCTCCCGCATTGCCGTTGCCGCGAGCTTGATATCCGCTGCCATTGC...
Protein
Download Protein FASTA1175 aa · LXL04_008174|LXL04_008174|OH1004|PROTEIN
MILHRIFIIRATVSNHHRRHVSNFSPRRLFSSSPSGNNHENSTVTRKNLKKLQNAGSRLPFPLLNHLRPNSLSRIAVAASLISAAIAASCMSVFDNDEFEKKHAKKKLVFRDITIDRSNESFRRILDTVKNTGVAVSVLWKSLSSVLSSANNEVRSGFEVRVAALLADIVAGDESRRAAIVGAGGGLVVDWLLESVALKGGGNYGSQAESARALAYLIADSNVSQAVLRRPHAIPNLIRFIFSARPHPSEQQTRHNSFDT...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_008174 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_008174 |
|---|---|
| Location | Chr02:90888011-90892222 (+) |
| Description | Similar to SERAC1: Protein SERAC1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0008654 phospholipid biosynthetic process Biological Process GO:0030198 extracellular matrix organization Biological Process GO:0032367 intracellular cholesterol transport Biological Process GO:0036148 phosphatidylglycerol acyl-chain remodeling Biological Process GO:0005739 mitochondrion Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0031012 extracellular matrix Cellular Component GO:0031966 mitochondrial membrane Cellular Component GO:0044233 mitochondria-associated endoplasmic reticulum membrane contact site Cellular Component |
| KEGG gene cross-reference | bta:519860 hsa:84947 mmu:321007 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.