LXL04_007706 | RubberDandelionOmics

Gene overview

LXL04_007706

Reference: OH-1004 Chr: Chr02 Coordinates: 57328721-57330689 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1062 bp · LXL04_007706|LXL04_007706|OH1004|cDNA

ATGCAGAGAGCTGTTGTTTCGGGGATGGTGGATACCAAGGTAGAAACAATATCCAGGTTGGCTCAATGGAGGATCGACAATTTTGGACCTTGTACTTACAAAAGGTCGGAACCTTTTAAAATCGGCATATGGAATTGGCAAATATCAGTCGAGAAGAATCGCCATCTGTACGTTCGTCTGTTTCCAGAGCCGTCTCGCATATCTAAAGAACAGCCGCCGATTGCCAAGTTCATAATACGAGTCACCACTGCGGGATCAAA...

CDS

Download CDS FASTA

1062 bp · LXL04_007706|LXL04_007706|OH1004|CDS

ATGCAGAGAGCTGTTGTTTCGGGGATGGTGGATACCAAGGTAGAAACAATATCCAGGTTGGCTCAATGGAGGATCGACAATTTTGGACCTTGTACTTACAAAAGGTCGGAACCTTTTAAAATCGGCATATGGAATTGGCAAATATCAGTCGAGAAGAATCGCCATCTGTACGTTCGTCTGTTTCCAGAGCCGTCTCGCATATCTAAAGAACAGCCGCCGATTGCCAAGTTCATAATACGAGTCACCACTGCGGGATCAAA...

Protein

Download Protein FASTA

353 aa · LXL04_007706|LXL04_007706|OH1004|PROTEIN

MQRAVVSGMVDTKVETISRLAQWRIDNFGPCTYKRSEPFKIGIWNWQISVEKNRHLYVRLFPEPSRISKEQPPIAKFIIRVTTAGSNRRPYISPKFGSTENQSTKGNGNYSKTVHERLLRTSEDFVWPVDSTFHGRFIIDVEFLDLQVYSPNGEEASSIWPSDVMLRSSATESILRCLSRMLHESIDADVTINTCDGSLKGHKAILSASSPVFQSMFLHNLQEKESSTINIQDMSLESCTALLSYLYGSIKQEEFWRHRL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007706`
TK1151 ID	TkA03G208990
OH-1004 ID	LXL04_007706
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007706

Location Chr02:57328721-57330689 (+)

Description Similar to At1g21780: BTB/POZ domain-containing protein At1g21780

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g21780`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g55760`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007706 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000132 establishment of mitotic spindle orientation Biological Process

GO:0000209 protein polyubiquitination Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010507 negative regulation of autophagy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030162 regulation of proteolysis Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0030307 positive regulation of cell growth Biological Process

GO:0032888 regulation of mitotic spindle elongation Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0071233 cellular response to L-leucine Biological Process

GO:1904263 positive regulation of TORC1 signaling Biological Process

KEGG gene cross-reference

ath:AT1G21780

ath:AT1G55760

cel:CELE_ZK858.4

xla:779391

xtr:394599

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.600

Rank 1 · LXL04_007706 · OH-1004

Nucleus0.374

Rank 2 · LXL04_007706 · OH-1004

Cell membrane0.109

Rank 3 · LXL04_007706 · OH-1004

Mitochondrion0.099

Rank 4 · LXL04_007706 · OH-1004

Endoplasmic reticulum0.063

Rank 5 · LXL04_007706 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651.38BTB182-284 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007706	`PF00651.38`	BTB	182	284	2.3e-22	80.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XHZ8`	Arabidopsis thaliana	BTB/POZ domain-containing protein At1g21780	66.667%	Swiss-Prot	strong database homology
`Q680K8`	Arabidopsis thaliana	BTB/POZ domain-containing protein At1g55760	48.824%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card