LXL04_007634 | RubberDandelionOmics

Gene overview

LXL04_007634

Reference: OH-1004 Chr: Chr02 Coordinates: 54877135-54882660 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3192 bp · LXL04_007634|LXL04_007634|OH1004|cDNA

ATGATTATTTTGGATGCAGCTGTCACTGTCTACCAATACTATACTGCACGGGAGACCAATACTATACTGCACGGAAGCAGGCGTTTGTTCTTATCGTTTTTGGGGGTCGATTTTCTCTTCATCCTTCCAGGCTCCACACCAAATCTTCACAGACGGGAAGCGAAGACGATGAAGTGGTTGGTCAATATATTAGCTTTGCTAGTGCTCCTCTGGTTTTGGGGCGGAGAGTCCAAGTATATGGTGTATGATACTTCTCAAAG...

CDS

Download CDS FASTA

3192 bp · LXL04_007634|LXL04_007634|OH1004|CDS

ATGATTATTTTGGATGCAGCTGTCACTGTCTACCAATACTATACTGCACGGGAGACCAATACTATACTGCACGGAAGCAGGCGTTTGTTCTTATCGTTTTTGGGGGTCGATTTTCTCTTCATCCTTCCAGGCTCCACACCAAATCTTCACAGACGGGAAGCGAAGACGATGAAGTGGTTGGTCAATATATTAGCTTTGCTAGTGCTCCTCTGGTTTTGGGGCGGAGAGTCCAAGTATATGGTGTATGATACTTCTCAAAG...

Protein

Download Protein FASTA

1063 aa · LXL04_007634|LXL04_007634|OH1004|PROTEIN

MIILDAAVTVYQYYTARETNTILHGSRRLFLSFLGVDFLFILPGSTPNLHRREAKTMKWLVNILALLVLLWFWGGESKYMVYDTSQRMQSGKINVHLVPHSHDDVGWLKTVDQYYTGANNSIRGACVQNVLDSVISALLDDKNRKFIYVEMAFFQRWWNQQSELLKSKVKELVKTGQLEFINGGMCMHDEATPHYIDLIDQTTLGHMFIQGEFGQTPRVGWQIDPFGHSSVQAYLLGAEVGFDSLFFARMDYQDRAKRKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007634`
TK1151 ID	TkA03G200520
OH-1004 ID	LXL04_007634
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.902 / OH-1004 92.192 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007634

Location Chr02:54877135-54882660 (+)

Description Similar to At3g26720: Alpha-mannosidase At3g26720

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26720`	Liberates mannose from p-nitrophenyl-alpha-D-mannoside in vitro.	No verified direct reference in this release
`At5g13980`	Liberates mannose from p-nitrophenyl-alpha-D-mannoside in vitro.	No verified direct reference in this release
`At5g66150`	Liberates mannose from p-nitrophenyl-alpha-D-mannoside in vitro.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007634 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006013 mannose metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0000326 protein storage vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0043202 lysosomal lumen Cellular Component

GO:0048046 apoplast Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0004559 alpha-mannosidase activity Molecular Function

GO:0030246 carbohydrate binding Molecular Function

KEGG gene cross-reference

ath:AT3G26720

ath:AT5G13980

ath:AT5G66150

cpoc:100718205

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.357

Rank 1 · LXL04_007634 · OH-1004

Endoplasmic reticulum0.204

Rank 2 · LXL04_007634 · OH-1004

Golgi apparatus0.186

Rank 3 · LXL04_007634 · OH-1004

Extracellular0.142

Rank 4 · LXL04_007634 · OH-1004

Cytoplasm0.131

Rank 5 · LXL04_007634 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01074.29Glyco_hydro_38N92-406 aa

PF09261.17Alpha-mann_mid411-502 aa

PF21260.4Laman-like_dom572-623 aa

PF07748.20Glyco_hydro_38C653-861 aa

PF17677.8Glyco_hydro38C2947-1049 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007634	`PF01074.29`	Glyco_hydro_38N	92	406	1.1e-91	307.7
LXL04_007634	`PF09261.17`	Alpha-mann_mid	411	502	6.4e-19	68.6
LXL04_007634	`PF21260.4`	Laman-like_dom	572	623	1.1e-07	32.7
LXL04_007634	`PF07748.20`	Glyco_hydro_38C	653	861	1.7e-44	153.3
LXL04_007634	`PF17677.8`	Glyco_hydro38C2	947	1049	3.1e-07	31.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P94078`	Arabidopsis thaliana	Alpha-mannosidase At3g26720	69.832%	Swiss-Prot	strong database homology
`Q8LPJ3`	Arabidopsis thaliana	Probable alpha-mannosidase At5g13980	64.764%	Swiss-Prot	strong database homology
`Q9FKW9`	Arabidopsis thaliana	Probable alpha-mannosidase At5g66150	56.032%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card