LXL04_007592 | RubberDandelionOmics

Gene overview

LXL04_007592

Reference: OH-1004 Chr: Chr02 Coordinates: 53286477-53287551 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

453 bp · LXL04_007592|LXL04_007592|OH1004|cDNA

ATGTCGAAGAGAAAGGTTAGGGAGCCAAAAGAAGAAAATGTTACCCTTGGACCTGCAACCCGTGAGGGAGAGCTTGTATTTGGTGTGGCACACATCTTTGCATCGTTCAATGATACCTTCATTCATGTAACTGATATCTCCGGAAGAGAAACCATGGTCCGGATTACTGGTGGGATGAAGGTGAAGGCTGACAGGGATGAATCCTCACCCTATGCAGCTATGCTTGCTGCACAAGATGTGTCCCAAAGATGCAAGGAACT...

CDS

Download CDS FASTA

453 bp · LXL04_007592|LXL04_007592|OH1004|CDS

ATGTCGAAGAGAAAGGTTAGGGAGCCAAAAGAAGAAAATGTTACCCTTGGACCTGCAACCCGTGAGGGAGAGCTTGTATTTGGTGTGGCACACATCTTTGCATCGTTCAATGATACCTTCATTCATGTAACTGATATCTCCGGAAGAGAAACCATGGTCCGGATTACTGGTGGGATGAAGGTGAAGGCTGACAGGGATGAATCCTCACCCTATGCAGCTATGCTTGCTGCACAAGATGTGTCCCAAAGATGCAAGGAACT...

Protein

Download Protein FASTA

150 aa · LXL04_007592|LXL04_007592|OH1004|PROTEIN

MSKRKVREPKEENVTLGPATREGELVFGVAHIFASFNDTFIHVTDISGRETMVRITGGMKVKADRDESSPYAAMLAAQDVSQRCKELGINALHIKLRATGGNKTKTPGPGAQSALRALARSGMKIGRIEDVTPIPTDSTRRKGGRRGRRL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007592`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007592

Location Chr02:53286477-53287551 (+)

Description Similar to RPS14C: 40S ribosomal protein S14-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52580`	Small ribosomal subunit protein uS11x.	No verified direct reference in this release
`At3g11510`	Small ribosomal subunit protein uS11y.	No verified direct reference in this release
`At2g36160`	Small ribosomal subunit protein uS11z.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007592 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000028 ribosomal small subunit assembly Biological Process

GO:0006412 translation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

KEGG gene cross-reference

ath:AT2G36160

ath:AT3G11510

ath:AT3G52580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.879

Rank 1 · LXL04_007592 · OH-1004

Nucleus0.248

Rank 2 · LXL04_007592 · OH-1004

Endoplasmic reticulum0.112

Rank 3 · LXL04_007592 · OH-1004

Mitochondrion0.026

Rank 4 · LXL04_007592 · OH-1004

Plastid0.022

Rank 5 · LXL04_007592 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00411.25Ribosomal_S1128-146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007592	`PF00411.25`	Ribosomal_S11	28	146	2.8e-47	160.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P42036`	Arabidopsis thaliana	Small ribosomal subunit protein uS11x	90.647%	Swiss-Prot	strong database homology
`Q9CAX6`	Arabidopsis thaliana	Small ribosomal subunit protein uS11y	89.928%	Swiss-Prot	strong database homology
`Q9SIH0`	Arabidopsis thaliana	Small ribosomal subunit protein uS11z	89.209%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card