LXL04_007451 | RubberDandelionOmics

Gene overview

LXL04_007451

Reference: OH-1004 Chr: Chr02 Coordinates: 48924667-48927881 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1493 bp · LXL04_007451|LXL04_007451|OH1004|cDNA

ATGCTTCGCCGTCGGATTCCAAACACAAACTTGGCTAAACCATGGCTGCTCAAATCTCTGGCATTTCTTCCACGTGCTCCACAGCCTCCTGCAAAGACCAGTCTCTCAAACTCGATTTTGATTCACTGTGCTCCAACAGATCAACTTCAATCTCGTTTTCTTCTCAGCTGAACACCAATTTGTCAATCAAATCTTTAGAGACTAGAAGAATGCGTAAGCTCTCTACAATCTGTTCAGCAGTAATATTAGAAAGCAACTCT...

CDS

Download CDS FASTA

1452 bp · LXL04_007451|LXL04_007451|OH1004|CDS

ATGGCTGCTCAAATCTCTGGCATTTCTTCCACGTGCTCCACAGCCTCCTGCAAAGACCAGTCTCTCAAACTCGATTTTGATTCACTGTGCTCCAACAGATCAACTTCAATCTCGTTTTCTTCTCAGCTGAACACCAATTTGTCAATCAAATCTTTAGAGACTAGAAGAATGCGTAAGCTCTCTACAATCTGTTCAGCAGTAATATTAGAAAGCAACTCTGAGAAAATGGAACTTGATACGAGTCTGAGCCCTAGAGTCAA...

Protein

Download Protein FASTA

483 aa · LXL04_007451|LXL04_007451|OH1004|PROTEIN

MAAQISGISSTCSTASCKDQSLKLDFDSLCSNRSTSISFSSQLNTNLSIKSLETRRMRKLSTICSAVILESNSEKMELDTSLSPRVNSVKPSKTVAITDQATALVEAGVPVIRLAAGEPDFDTPSVIAEAGINAIREGYTRYTPNAGTLELRTAICKKLKDENDISYTPDQIVVSNGAKQSILQAILAVCSPGDEVMIPAPFWVSYPEMARLADATPVILPASISENFLLDPKLLEAKLTDKSRLLILCSPSNPTGSVYP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007451`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007451

Location Chr02:48924667-48927881 (+)

Description Similar to Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22250`	Prokaryotic-type aspartate aminotransferase.	Identification of a plant gene encoding glutamate/aspartate-prephenate aminotransferase: the last homeless enzyme of aromatic amino acids biosynthesis.2010 · DOI: 10.1016/j.febslet.2010.09.037

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007451 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006520 amino acid metabolic process Biological Process

GO:0009094 L-phenylalanine biosynthetic process Biological Process

GO:0009095 aromatic amino acid family biosynthetic process, prephenate pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004069 L-aspartate:2-oxoglutarate aminotransferase activity Molecular Function

GO:0008483 transaminase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0033853 aspartate-prephenate aminotransferase activity Molecular Function

GO:0033854 glutamate-prephenate aminotransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G22250

cte:CT0966

rpr:RP091

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.978

Rank 1 · LXL04_007451 · OH-1004

Mitochondrion0.041

Rank 2 · LXL04_007451 · OH-1004

Cytoplasm0.023

Rank 3 · LXL04_007451 · OH-1004

Peroxisome0.022

Rank 4 · LXL04_007451 · OH-1004

Cell membrane0.013

Rank 5 · LXL04_007451 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00155.28Aminotran_1_2110-472 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007451	`PF00155.28`	Aminotran_1_2	110	472	4e-77	260.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIE1`	Arabidopsis thaliana	Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase	77.228%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card