LXL04_006809 | RubberDandelionOmics

Gene overview

LXL04_006809

Reference: OH-1004 Chr: Chr02 Coordinates: 25998192-25999506 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

768 bp · LXL04_006809|LXL04_006809|OH1004|cDNA

ATGGCGATGGACGGAGGAGAAGCTCAGATTGATCAGCTTCCGATGGACCTACTTGCTCATATATTCGTTTTCATCACTTGCTTCAAGGATTTGGCTCAGACGAGCAGTGTGTGTAAAAAATGGAGGGAAGGTGTGAAGCAATCGTTGGGGAGAAGAGAGAAATTGAGCTTTGCAGGCTGGAAAATGGACGATAAATCTACTtctcgtcttgtttgttatgCTTACGCTCTCAAGGAGCTTGACATTTCAAAAAGCCGATG...

CDS

Download CDS FASTA

768 bp · LXL04_006809|LXL04_006809|OH1004|CDS

ATGGCGATGGACGGAGGAGAAGCTCAGATTGATCAGCTTCCGATGGACCTACTTGCTCATATATTCGTTTTCATCACTTGCTTCAAGGATTTGGCTCAGACGAGCAGTGTGTGTAAAAAATGGAGGGAAGGTGTGAAGCAATCGTTGGGGAGAAGAGAGAAATTGAGCTTTGCAGGCTGGAAAATGGACGATAAATCTACTTCTCGTCTTGTTTGTTATGCTTACGCTCTCAAGGAGCTTGACATTTCAAAAAGCCGATG...

Protein

Download Protein FASTA

255 aa · LXL04_006809|LXL04_006809|OH1004|PROTEIN

MAMDGGEAQIDQLPMDLLAHIFVFITCFKDLAQTSSVCKKWREGVKQSLGRREKLSFAGWKMDDKSTSRLVCYAYALKELDISKSRWGCQITDNGLYQLSTAKCIINLTSISLWGMTGITDKGVVQLVSDHHFLLNHIVQLPNFQTLISIYSQISRANSLQHLNIGGTFITDESLFAISTSCPHLKSAVLWGCRHVTENGLQVLVNKCRKLESINVWGMRIALDSFIALLAIRPALQITPQTLLNIGNAPLLPVF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006809`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006809

Location Chr02:25998192-25999506 (-)

Description Similar to At5g67140: F-box protein At5g67140

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67140`	F-box protein At5g67140.	No verified direct reference in this release
`At1g77000`	Component of SCF(SKP2B) E3 ubiquitin ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of the cyclin-dependent kinase inhibitor KRP1.	Degradation of the cyclin-dependent kinase inhibitor KRP1 is regulated by two different ubiquitin E3 ligases.2008 · DOI: 10.1111/j.1365-313x.2007.03370.x
`At1g21410`	Component of SCF(SKP2A) E3 ubiquitin ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of target proteins (including cell cycle repressors).	The balance between cell division and endoreplication depends on E2FC-DPB, transcription factors regulated by the ubiquitin-SCFSKP2A pathway in Arabidopsis.2006 · DOI: 10.1105/tpc.105.039651 SKP2A protein, an F-box that regulates cell division, is degraded via the ubiquitin pathway.2008 · DOI: 10.4161/psb.3.10.5888 The Arabidopsis cell cycle F-box protein SKP2A binds to auxin.2010 · DOI: 10.1105/tpc.110.078972

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006809 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000086 G2/M transition of mitotic cell cycle Biological Process

GO:0000209 protein polyubiquitination Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010286 heat acclimation Biological Process

GO:0010311 lateral root formation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0051301 cell division Biological Process

GO:0051603 proteolysis involved in protein catabolic process Biological Process

GO:0051781 positive regulation of cell division Biological Process

KEGG gene cross-reference

ath:AT1G21410

ath:AT1G77000

ath:AT5G67140

hsa:23194

mmu:448987

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.389

Rank 1 · LXL04_006809 · OH-1004

Cytoplasm0.292

Rank 2 · LXL04_006809 · OH-1004

Mitochondrion0.164

Rank 3 · LXL04_006809 · OH-1004

Plastid0.102

Rank 4 · LXL04_006809 · OH-1004

Cell membrane0.048

Rank 5 · LXL04_006809 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937.13F-box-like10-43 aa

PF25372.2LRR_FBXL15153-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006809	`PF12937.13`	F-box-like	10	43	1.8e-07	31.5
LXL04_006809	`PF25372.2`	LRR_FBXL15	153	207	1.1e-10	41.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH99`	Arabidopsis thaliana	F-box protein At5g67140	63.158%	Swiss-Prot	strong database homology
`O49286`	Arabidopsis thaliana	F-box protein SKP2B	26.104%	Swiss-Prot	weak database homology
`Q9LPL4`	Arabidopsis thaliana	F-box protein SKP2A	24.701%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card