LXL04_006805 | RubberDandelionOmics

Gene overview

LXL04_006805

Reference: OH-1004 Chr: Chr02 Coordinates: 25915867-25921627 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2826 bp · LXL04_006805|LXL04_006805|OH1004|cDNA

ATGAGTCCGATCTCGTCGCCGGTGTGTACTCCTCAGCAGCTTACACTCTTGGCGACCGGAAATGTCGTCGCCGAAGCTCCCTCTTCCATCGTGTTCCGCCGCCGGCCGATCCGAGTCTCCGGATGCATCTACGGTACTATTGTGGGAGTAGAAGGAGCAACTATTCCTCCTGCAGAAATATCACTGGTAATCGACTCATTCAAGAAGAACGTTGATGCTGATCGTTGTGTTTATATCATgAAAAGAATGGAAGAAAACAG...

CDS

Download CDS FASTA

2826 bp · LXL04_006805|LXL04_006805|OH1004|CDS

ATGAGTCCGATCTCGTCGCCGGTGTGTACTCCTCAGCAGCTTACACTCTTGGCGACCGGAAATGTCGTCGCCGAAGCTCCCTCTTCCATCGTGTTCCGCCGCCGGCCGATCCGAGTCTCCGGATGCATCTACGGTACTATTGTGGGAGTAGAAGGAGCAACTATTCCTCCTGCAGAAATATCACTGGTAATCGACTCATTCAAGAAGAACGTTGATGCTGATCGTTGTGTTTATATCATGAAAAGAATGGAAGAAAACAG...

Protein

Download Protein FASTA

941 aa · LXL04_006805|LXL04_006805|OH1004|PROTEIN

MSPISSPVCTPQQLTLLATGNVVAEAPSSIVFRRRPIRVSGCIYGTIVGVEGATIPPAEISLVIDSFKKNVDADRCVYIMKRMEENRIKLAEVTSNHHKLSTERRNLKTSGTDVDLLTKRQKDAIDMQNGVNANNGDSDSSSSQEDGHASAILLGSSIAVKNAVRPIKLPEVNKLPPYTTWIFLDRCPSSILLNLISNQSPLSFSKINQRMTEDQSVLGRRRIYYDQNGGEALICSDSEEEAIDEEEEKKEFVESEDYII...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006805`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006805

Location Chr02:25915867-25921627 (+)

Description Similar to CLF: Histone-lysine N-methyltransferase CLF

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g23380`	Polycomb group (PcG) protein.	Genetic analysis of incurvata mutants reveals three independent genetic operations at work in Arabidopsis leaf morphogenesis.2000 · DOI: 10.1093/genetics/156.3.1363

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0275500`	Polycomb group (PcG) protein.	The rice enhancer of zeste [E(z)] genes SDG711 and SDG718 are respectively involved in long day and short day signaling to mediate the accurate photoperiod control of flowering time.2014 · DOI: 10.3389/fpls.2014.00591
`Os03g0307800`	Polycomb group (PcG) protein.	The rice enhancer of zeste [E(z)] genes SDG711 and SDG718 are respectively involved in long day and short day signaling to mediate the accurate photoperiod control of flowering time.2014 · DOI: 10.3389/fpls.2014.00591
`UniProt: Q84UI6`	Polycomb group (PcG) protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006805 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0010048 vernalization response Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0030154 cell differentiation Biological Process

GO:0031507 heterochromatin formation Biological Process

KEGG gene cross-reference

ath:AT2G23380

dosa:Os03g0307800

dosa:Os06g0275500

osa:4340748

zma:541954

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · LXL04_006805 · OH-1004

Cytoplasm0.098

Rank 2 · LXL04_006805 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_006805 · OH-1004

Mitochondrion0.011

Rank 4 · LXL04_006805 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_006805 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25996.1HTH_CLF_N252-295 aa

PF21358.3Ezh2_MCSS323-346 aa

PF18264.7preSET_CXC729-760 aa

PF00856.34SET802-905 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006805	`PF25996.1`	HTH_CLF_N	252	295	1.2e-18	67.2
LXL04_006805	`PF21358.3`	Ezh2_MCSS	323	346	2.8e-06	27.7
LXL04_006805	`PF18264.7`	preSET_CXC	729	760	3.1e-07	31.5
LXL04_006805	`PF00856.34`	SET	802	905	1.6e-19	71.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93831`	Arabidopsis thaliana	Histone-lysine N-methyltransferase CLF	57.883%	Swiss-Prot	strong database homology
`Q5VN06`	Oryza sativa subsp. japonica	Histone-lysine N-methyltransferase CLF	55.850%	Swiss-Prot	strong database homology
`Q10MI4`	Oryza sativa subsp. japonica	Histone-lysine N-methyltransferase EZ1	48.519%	Swiss-Prot	moderate database homology
`Q84UI6`	Oryza sativa subsp. indica	Histone-lysine N-methyltransferase EZ1	47.960%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card