LXL04_006507 | RubberDandelionOmics

Gene overview

LXL04_006507

Reference: OH-1004 Chr: Chr02 Coordinates: 12509419-12512147 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1152 bp · LXL04_006507|LXL04_006507|OH1004|cDNA

ATGGGGATATGCTTGTCAGCGGAATCGCCGCCTAGGAAAAACCATTCGAAACGCGTCATAAATCAATCAACTACATCAGGCAATACCAATTCAAGCAATCGATGGTCTCGCGTTCGATCTCTGTCTAGCAGAAGAGAAAAATTCGATGATGCTATGATTCATGAACATGCAATCGCTGCCGCTCTCCTTTTCCAGCAACACCAGCAGCAAAATGGCGGTATTTTGCCTTTTGATCGATCAACTTCTCTCCGGCATCTACC...

CDS

Download CDS FASTA

1152 bp · LXL04_006507|LXL04_006507|OH1004|CDS

ATGGGGATATGCTTGTCAGCGGAATCGCCGCCTAGGAAAAACCATTCGAAACGCGTCATAAATCAATCAACTACATCAGGCAATACCAATTCAAGCAATCGATGGTCTCGCGTTCGATCTCTGTCTAGCAGAAGAGAAAAATTCGATGATGCTATGATTCATGAACATGCAATCGCTGCCGCTCTCCTTTTCCAGCAACACCAGCAGCAAAATGGCGGTATTTTGCCTTTTGATCGATCAACTTCTCTCCGGCATCTACC...

Protein

Download Protein FASTA

383 aa · LXL04_006507|LXL04_006507|OH1004|PROTEIN

MGICLSAESPPRKNHSKRVINQSTTSGNTNSSNRWSRVRSLSSRREKFDDAMIHEHAIAAALLFQQHQQQNGGILPFDRSTSLRHLPGSTNSKRHNPLPRSSSTRPRSVADPLLPPQQLLNQDLNIDELETSHIVLVHGGGFGAWCWYKTIALLEESKLKVTAIDLTGSGIDLFDTNSIKSLSQYVTPLIDFLKNLTDGEKVILVGHDFGGSCISYVMELFPSKIAKAIFVAASMLKSGQSTLDMFSQKENTNDLMRKSQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006507`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006507

Location Chr02:12509419-12512147 (-)

Description Similar to MES11: Putative methylesterase 11, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g29770`	Putative methylesterase.	No verified direct reference in this release
`At1g26360`	Putative methylesterase.	No verified direct reference in this release
`At1g69240`	Putative methylesterase.	No verified direct reference in this release
`At1g33990`	Putative methylesterase.	No verified direct reference in this release
`UniProt: Q940H7`	Putative methylesterase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006507 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009694 jasmonic acid metabolic process Biological Process

GO:0009696 salicylic acid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0080030 methyl indole-3-acetate esterase activity Molecular Function

GO:0080031 methyl salicylate esterase activity Molecular Function

GO:0080032 methyl jasmonate esterase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26360

ath:AT1G33990

ath:AT1G69240

ath:AT3G29770

ath:AT4G09900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.333

Rank 1 · LXL04_006507 · OH-1004

Cytoplasm0.296

Rank 2 · LXL04_006507 · OH-1004

Nucleus0.271

Rank 3 · LXL04_006507 · OH-1004

Plastid0.099

Rank 4 · LXL04_006507 · OH-1004

Endoplasmic reticulum0.076

Rank 5 · LXL04_006507 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561.27Abhydrolase_1133-290 aa

PF12146.16Hydrolase_4133-239 aa

PF12697.14Abhydrolase_6134-372 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006507	`PF00561.27`	Abhydrolase_1	133	290	1.6e-14	54.9
LXL04_006507	`PF12146.16`	Hydrolase_4	133	239	3.7e-08	33.7
LXL04_006507	`PF12697.14`	Abhydrolase_6	134	372	5.5e-18	67.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FW03`	Arabidopsis thaliana	Putative methylesterase 11, chloroplastic	69.318%	Swiss-Prot	strong database homology
`F4IE65`	Arabidopsis thaliana	Putative methylesterase 13, chloroplastic	53.561%	Swiss-Prot	strong database homology
`F4I0K9`	Arabidopsis thaliana	Putative methylesterase 15, chloroplastic	53.561%	Swiss-Prot	strong database homology
`Q9FVW3`	Arabidopsis thaliana	Putative methylesterase 14, chloroplastic	48.246%	Swiss-Prot	moderate database homology
`Q940H7`	Arabidopsis thaliana	Putative methylesterase 12, chloroplastic	45.682%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card