LXL04_006236 | RubberDandelionOmics

Gene overview

LXL04_006236

Reference: OH-1004 Chr: Chr02 Coordinates: 4554318-4557830 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1059 bp · LXL04_006236|LXL04_006236|OH1004|cDNA

ATGACTTACAGACTGCAATATGGAACTTCTTCAGTTGGAGGGTTTTATGCTGTCAATAGACGTGGACAGGTCCTACTTGCCACTGTAAATGAATCAACAATTGTGCCTTTTGTTAGCGGACAATTAAACAACCTGGAACTTGCAGTCAATCTTGCTAAAAGAGGAAACTTACCTGGTGCAGAGAATTTGTATTTTGGGACCCTTTTAACGAAAGGGAAGCTGAATGCATTTGAATCTTTGGAACTATCAAGAGCAACTCC...

CDS

Download CDS FASTA

1059 bp · LXL04_006236|LXL04_006236|OH1004|CDS

ATGACTTACAGACTGCAATATGGAACTTCTTCAGTTGGAGGGTTTTATGCTGTCAATAGACGTGGACAGGTCCTACTTGCCACTGTAAATGAATCAACAATTGTGCCTTTTGTTAGCGGACAATTAAACAACCTGGAACTTGCAGTCAATCTTGCTAAAAGAGGAAACTTACCTGGTGCAGAGAATTTGTATTTTGGGACCCTTTTAACGAAAGGGAAGCTGAATGCATTTGAATCTTTGGAACTATCAAGAGCAACTCC...

Protein

Download Protein FASTA

352 aa · LXL04_006236|LXL04_006236|OH1004|PROTEIN

MTYRLQYGTSSVGGFYAVNRRGQVLLATVNESTIVPFVSGQLNNLELAVNLAKRGNLPGAENLYFGTLLTKGKLNAFESLELSRATPKVVAAFAERREFDKILIYSKQVGYAPDYLFLLQTLLRSDPQSDIRPRTESDIRPRTKHLGLRTESDIRGKFPVCDFFGRTESEAKGRTESVVCSLTTLSNARTTDRVRGLQSESENVFIEDNSSKLDAVSLPAVMVFTRYVRRECTCLSLRGTKSISNKKALSKGITRSLNGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006236`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006236

Location Chr02:4554318-4557830 (-)

Description Similar to CHC2: Clathrin heavy chain 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g08530`	Clathrin is the major protein of the polyhedral coat of coated pits and vesicles (By similarity).	Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis.2011 · DOI: 10.1105/tpc.111.083030
`At3g11130`	Clathrin is the major protein of the polyhedral coat of coated pits and vesicles (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0104900`	Clathrin is the major protein of the polyhedral coat of coated pits and vesicles.	No verified direct reference in this release
`Os12g0104800`	Clathrin is the major protein of the polyhedral coat of coated pits and vesicles.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006236 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0000915 actomyosin contractile ring assembly Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0006898 receptor-mediated endocytosis Biological Process

GO:0006907 pinocytosis Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0007033 vacuole organization Biological Process

GO:0007041 lysosomal transport Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0010118 stomatal movement Biological Process

GO:0016192 vesicle-mediated transport Biological Process

KEGG gene cross-reference

ath:AT3G08530

ath:AT3G11130

ddi:DDB_G0277221

osa:4349546

osa:4351255

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.446

Rank 1 · LXL04_006236 · OH-1004

Nucleus0.352

Rank 2 · LXL04_006236 · OH-1004

Mitochondrion0.203

Rank 3 · LXL04_006236 · OH-1004

Cell membrane0.087

Rank 4 · LXL04_006236 · OH-1004

Endoplasmic reticulum0.056

Rank 5 · LXL04_006236 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09268.17Clathrin-link31-54 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006236	`PF09268.17`	Clathrin-link	31	54	9.4e-10	38.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WLB5`	Arabidopsis thaliana	Clathrin heavy chain 2	49.099%	Swiss-Prot	weak database homology
`Q0WNJ6`	Arabidopsis thaliana	Clathrin heavy chain 1	48.649%	Swiss-Prot	weak database homology
`Q2RBN7`	Oryza sativa subsp. japonica	Clathrin heavy chain 1	47.748%	Swiss-Prot	weak database homology
`Q2QYW2`	Oryza sativa subsp. japonica	Clathrin heavy chain 2	47.748%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card