LXL04_006078 | RubberDandelionOmics

Gene overview

LXL04_006078

Reference: OH-1004 Chr: Chr02 Coordinates: 1404450-1408076 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

762 bp · LXL04_006078|LXL04_006078|OH1004|cDNA

ATGGACGAAGGAATCAAGGAGAAGTTCTTTTCAGATTTGAGTCGCTTTTATCATCAGAAACCGGAGGTCGATGCTCTGATTCACGGTTTCGAAAATGTAGGCCTGAAATCCTACCAATCCGATACTGCTTCGGACAATGTCCAGGATCCGAGACCCGATGGCGATCACAGCACCGGCAATCGTAACATGCATCACCCGATTCGAATCGGGGCTGAAGACTGCTCGTTTTTTGTTCGAACTGGGACGTGCAAGTTTGGGCG...

CDS

Download CDS FASTA

762 bp · LXL04_006078|LXL04_006078|OH1004|CDS

ATGGACGAAGGAATCAAGGAGAAGTTCTTTTCAGATTTGAGTCGCTTTTATCATCAGAAACCGGAGGTCGATGCTCTGATTCACGGTTTCGAAAATGTAGGCCTGAAATCCTACCAATCCGATACTGCTTCGGACAATGTCCAGGATCCGAGACCCGATGGCGATCACAGCACCGGCAATCGTAACATGCATCACCCGATTCGAATCGGGGCTGAAGACTGCTCGTTTTTTGTTCGAACTGGGACGTGCAAGTTTGGGCG...

Protein

Download Protein FASTA

253 aa · LXL04_006078|LXL04_006078|OH1004|PROTEIN

MDEGIKEKFFSDLSRFYHQKPEVDALIHGFENVGLKSYQSDTASDNVQDPRPDGDHSTGNRNMHHPIRIGAEDCSFFVRTGTCKFGRTCKFNHPVSNIAHVDQGKSNENGAESSSKSLSRIPCKFYQTGFCKYGDSCRFSHSIFPQHNVLGLPKRWGQRFCSFYMRTGVCGYGTSCRFHHPQPFFFFLESNQEQEQEEQEINGQDFSEKSTTSHVRTLQFGSLPYGFDVYQKKNGHSLIDGSTSESPSGGKTK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006078`
TK1151 ID	TkA03G008310
OH-1004 ID	LXL04_006078
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.800
Protein coverage (%)	TK1151 96.899 / OH-1004 98.814 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006078

Location Chr02:1404450-1408076 (+)

Description Similar to At3g48440: Zinc finger CCCH domain-containing protein 43

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48440`	Zinc finger CCCH domain-containing protein 43.	No verified direct reference in this release
`At5g63260`	Zinc finger CCCH domain-containing protein 67.	No verified direct reference in this release
`At1g04990`	Possesses RNA-binding and ribonuclease activities in vitro.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0472000`	Zinc finger CCCH domain-containing protein 63.	No verified direct reference in this release
`Os12g0405100`	Zinc finger CCCH domain-containing protein 66.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006078 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G48440

ath:AT5G63260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.747

Rank 1 · LXL04_006078 · OH-1004

Cytoplasm0.299

Rank 2 · LXL04_006078 · OH-1004

Cell membrane0.036

Rank 3 · LXL04_006078 · OH-1004

Endoplasmic reticulum0.026

Rank 4 · LXL04_006078 · OH-1004

Mitochondrion0.024

Rank 5 · LXL04_006078 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00642.31zf-CCCH72-94 aa

PF25585.2zf-CCCH_DUS3L72-93 aa

PF00642.31zf-CCCH121-142 aa

PF18044.8zf-CCCH_4122-141 aa

PF14608.13zf-CCCH_2122-141 aa

PF25585.2zf-CCCH_DUS3L123-143 aa

PF18345.8zf_CCCH_4123-141 aa

PF25261.2zf-CCCH_PARP12123-148 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006078	`PF00642.31`	zf-CCCH	72	94	3.9e-26	91.1
LXL04_006078	`PF25585.2`	zf-CCCH_DUS3L	72	93	1.5e-14	54.3
LXL04_006078	`PF00642.31`	zf-CCCH	121	142	3.9e-26	91.1
LXL04_006078	`PF18044.8`	zf-CCCH_4	122	141	3.2e-12	46.6
LXL04_006078	`PF14608.13`	zf-CCCH_2	122	141	8.4e-11	42.7
LXL04_006078	`PF25585.2`	zf-CCCH_DUS3L	123	143	1.5e-14	54.3
LXL04_006078	`PF18345.8`	zf_CCCH_4	123	141	1.6e-14	54.1
LXL04_006078	`PF25261.2`	zf-CCCH_PARP12	123	148	1.3e-06	29.2
LXL04_006078	`PF00642.31`	zf-CCCH	161	182	3.9e-26	91.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STM4`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 43	47.244%	Swiss-Prot	weak database homology
`Q5RJC5`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 67	45.736%	Swiss-Prot	weak database homology
`Q94AD9`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 3	35.849%	Swiss-Prot	moderate database homology
`Q2R4J4`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 63	40.157%	Swiss-Prot	weak database homology
`Q2QT65`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 66	40.945%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card