Gene Card
Gene overview
cDNA / CDS / Protein Sequences
666 bp · LXL04_006065|LXL04_006065|OH1004|cDNA
ATGGGTAGCAACCAAGCGGCAGTGTCCTTCTTGACCAATATAGCACGCGCCGCCCTGGGCCTTGGCGCCTCGGCCACCATCCTCAACTCCTCCCTCTACACCGTCGACGGTGGCCAGCGTGCTGTCCTCTTCGATCGTTTCCGTGGAGTCATTGACGATACTGTCGGCGAAGGTACTCATTTTCTCGTTCCATGGCTCCAAAAACCCTACATCTTCGATATCCGTACGAAGCCCCATACTTTCTCTTCCATATCCGGTAC...
666 bp · LXL04_006065|LXL04_006065|OH1004|CDS
ATGGGTAGCAACCAAGCGGCAGTGTCCTTCTTGACCAATATAGCACGCGCCGCCCTGGGCCTTGGCGCCTCGGCCACCATCCTCAACTCCTCCCTCTACACCGTCGACGGTGGCCAGCGTGCTGTCCTCTTCGATCGTTTCCGTGGAGTCATTGACGATACTGTCGGCGAAGGTACTCATTTTCTCGTTCCATGGCTCCAAAAACCCTACATCTTCGATATCCGTACGAAGCCCCATACTTTCTCTTCCATATCCGGTAC...
Protein
Download Protein FASTA221 aa · LXL04_006065|LXL04_006065|OH1004|PROTEIN
MGSNQAAVSFLTNIARAALGLGASATILNSSLYTVDGGQRAVLFDRFRGVIDDTVGEGTHFLVPWLQKPYIFDIRTKPHTFSSISGTKDLQMVNLTLRVLSRPEVNKLPSIFKTLGLEYDEKVLPSIGNEVLKAVVAQFNADQLLTERPHVSALVRDSLIRRAKDFNIVLDDVAITHLSYGAEFSKAVEQKQVAQQEAERSKFVALIHLAKLDVMAKWINV
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_006065 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_006065 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:1292486-1293561 (+) | |||||||||
| Description | Similar to PHB3: Prohibitin-3, mitochondrial | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000001 mitochondrion inheritance Biological Process GO:0000423 mitophagy Biological Process GO:0006457 protein folding Biological Process GO:0007005 mitochondrion organization Biological Process GO:0007007 inner mitochondrial membrane organization Biological Process GO:0009651 response to salt stress Biological Process GO:0009697 salicylic acid biosynthetic process Biological Process GO:0009723 response to ethylene Biological Process GO:0009733 response to auxin Biological Process GO:0033615 mitochondrial proton-transporting ATP synthase complex assembly Biological Process GO:0042742 defense response to bacterium Biological Process GO:0045861 negative regulation of proteolysis Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G27280 ath:AT5G40770 ddi:DDB_G0290123 spo:2542354 vda:VDAG_00218 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01145.32Band_734-202 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_006065 | PF01145.32 | Band_7 | 34 | 202 | 9.3e-28 | 98.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.