LXL04_005829 | RubberDandelionOmics

Gene overview

LXL04_005829

Reference: OH-1004 Chr: Chr01 Coordinates: 174231247-174235062 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1386 bp · LXL04_005829|LXL04_005829|OH1004|cDNA

ATGGAGGTGGAAATGGAGGATGATAATAGTAGTGATAATGTGGCTGTGGAGTTTACGTTTACGGCTGTGGAAATCGATCTCGATTACGAGTTTGAAGCCGCGCGGTTCTTCGATTTTACAAGGGAGGAGTCGACGGACGAAGCTCGTGAAGCTGAAATGTGGTTTGATTCCGTTGAAAGCTATCCGCCTTCGCCATTTGCAGCCAGATTACTTTCAAGAGAGAAAGATGGAAATGAATCAAAAGGATTTAACACAAATCA...

CDS

Download CDS FASTA

1386 bp · LXL04_005829|LXL04_005829|OH1004|CDS

ATGGAGGTGGAAATGGAGGATGATAATAGTAGTGATAATGTGGCTGTGGAGTTTACGTTTACGGCTGTGGAAATCGATCTCGATTACGAGTTTGAAGCCGCGCGGTTCTTCGATTTTACAAGGGAGGAGTCGACGGACGAAGCTCGTGAAGCTGAAATGTGGTTTGATTCCGTTGAAAGCTATCCGCCTTCGCCATTTGCAGCCAGATTACTTTCAAGAGAGAAAGATGGAAATGAATCAAAAGGATTTAACACAAATCA...

Protein

Download Protein FASTA

461 aa · LXL04_005829|LXL04_005829|OH1004|PROTEIN

MEVEMEDDNSSDNVAVEFTFTAVEIDLDYEFEAARFFDFTREESTDEAREAEMWFDSVESYPPSPFAARLLSREKDGNESKGFNTNQLNNVSYENANILSSSMPLNNTDGDVANRGLGVHLDLKSYSLQTFQKPQPKRNDNFKSKTKSRTSTLMKPTASQLAKQNQERLIDHSRFPKSGNSSVNVEGQAAKRQKLEGGLLCKVTDTKQQANFIHKAPKREGGVDGNKMHITVPRQPELATAQRALRSQRIRQKGDTGNEH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005829`
TK1151 ID	TkA01G013910
OH-1004 ID	LXL04_005829
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005829

Location Chr01:174231247-174235062 (+)

Description Similar to TPX2: Protein TPX2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g03780`	Regulates prospindle assembly during late prophase and at the onset of mitosis, before nuclear envelope breakdown (NEB).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005829 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051301 cell division Biological Process

GO:0060236 regulation of mitotic spindle organization Biological Process

GO:0090307 mitotic spindle assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005819 spindle Cellular Component

GO:0005874 microtubule Cellular Component

GO:0005880 nuclear microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0009941 chloroplast envelope Cellular Component

KEGG gene cross-reference

ath:AT1G03780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.614

Rank 1 · LXL04_005829 · OH-1004

Nucleus0.420

Rank 2 · LXL04_005829 · OH-1004

Cell membrane0.073

Rank 3 · LXL04_005829 · OH-1004

Endoplasmic reticulum0.039

Rank 4 · LXL04_005829 · OH-1004

Mitochondrion0.021

Rank 5 · LXL04_005829 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12214.14TPX2_importin229-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005829	`PF12214.14`	TPX2_importin	229	384	2.9e-36	125.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I2H7`	Arabidopsis thaliana	Protein TPX2	40.553%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card