LXL04_005573 | RubberDandelionOmics

Gene overview

LXL04_005573

Reference: OH-1004 Chr: Chr01 Coordinates: 168580774-168592708 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

8643 bp · LXL04_005573|LXL04_005573|OH1004|cDNA

ATGGCTGAAATCGTTGTTAGCGCCGTTATCAGCGTGCTGTGTGAAAAGCTGATCTCTGGAGACTTGCTGAAGTTGGCTCGATCAGAAGGGATCGACTCTCAGCTGCAGAAATTGAAGAAAAACTTGCCGCTGATCCAAGCGGTACTTGCTGATGCAAGCCAGAAGCACATAACAGACAGAGCTGTTCAATTGTGGGTGAAAGAGCTCCAGGAATTGGCTTATGACATAGAAGATGTACTTGATGATATGGCAACCGAAGC...

CDS

Download CDS FASTA

8643 bp · LXL04_005573|LXL04_005573|OH1004|CDS

ATGGCTGAAATCGTTGTTAGCGCCGTTATCAGCGTGCTGTGTGAAAAGCTGATCTCTGGAGACTTGCTGAAGTTGGCTCGATCAGAAGGGATCGACTCTCAGCTGCAGAAATTGAAGAAAAACTTGCCGCTGATCCAAGCGGTACTTGCTGATGCAAGCCAGAAGCACATAACAGACAGAGCTGTTCAATTGTGGGTGAAAGAGCTCCAGGAATTGGCTTATGACATAGAAGATGTACTTGATGATATGGCAACCGAAGC...

Protein

Download Protein FASTA

2880 aa · LXL04_005573|LXL04_005573|OH1004|PROTEIN

MAEIVVSAVISVLCEKLISGDLLKLARSEGIDSQLQKLKKNLPLIQAVLADASQKHITDRAVQLWVKELQELAYDIEDVLDDMATEAIRRKLTQEPSASTSNVTGKVLKLFPGCCTNFTPHNITYGRQMRSKLDEISNKLRDLVDQKNDLGLNVNVGRSNERERRQEETSLVDESKIMGREGDKEALLEKLLGNEECVGNVSIVSIVGMGGIGKTTLAKLLYNDQKVKDQFQLKAWVCVSEELDVFTVSKAIFQAVTGEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005573`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005573

Location Chr01:168580774-168592708 (+)

Description Similar to RPPL1: Putative disease resistance RPP13-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release
`At3g14460`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005573 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0004016 adenylate cyclase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G14460

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.476

Rank 1 · LXL04_005573 · OH-1004

Cytoplasm0.309

Rank 2 · LXL04_005573 · OH-1004

Nucleus0.176

Rank 3 · LXL04_005573 · OH-1004

Endoplasmic reticulum0.083

Rank 4 · LXL04_005573 · OH-1004

Plastid0.048

Rank 5 · LXL04_005573 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052.7Rx_N5-94 aa

PF00931.29NB-ARC181-351 aa

PF23559.2WHD_DRP438-506 aa

PF23598.2LRR_14580-914 aa

PF25013.1LRR_Zer-1618-679 aa

PF25019.1LRR_R13L1-DRL21710-836 aa

PF23247.2LRR_RPS2921-995 aa

PF23247.2LRR_RPS2927-1029 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005573	`PF18052.7`	Rx_N	5	94	2e-44	150.3
LXL04_005573	`PF00931.29`	NB-ARC	181	351	4e-75	251.9
LXL04_005573	`PF23559.2`	WHD_DRP	438	506	3.6e-50	168.6
LXL04_005573	`PF23598.2`	LRR_14	580	914	1.7e-72	244.9
LXL04_005573	`PF25013.1`	LRR_Zer-1	618	679	3.7e-13	50.5
LXL04_005573	`PF25019.1`	LRR_R13L1-DRL21	710	836	6e-112	369.5
LXL04_005573	`PF23247.2`	LRR_RPS2	921	995	2.4e-32	112.9
LXL04_005573	`PF23247.2`	LRR_RPS2	927	1029	2.4e-32	112.9
LXL04_005573	`PF23598.2`	LRR_14	1147	1379	1.7e-72	244.9
LXL04_005573	`PF25019.1`	LRR_R13L1-DRL21	1199	1325	6e-112	369.5
LXL04_005573	`PF23247.2`	LRR_RPS2	1416	1516	2.4e-32	112.9
LXL04_005573	`PF18052.7`	Rx_N	1945	2034	2e-44	150.3
LXL04_005573	`PF00931.29`	NB-ARC	2121	2291	4e-75	251.9
LXL04_005573	`PF23559.2`	WHD_DRP	2378	2447	3.6e-50	168.6
LXL04_005573	`PF23598.2`	LRR_14	2516	2851	1.7e-72	244.9
LXL04_005573	`PF25019.1`	LRR_R13L1-DRL21	2642	2768	6e-112	369.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRR4`	Arabidopsis thaliana	Putative disease resistance RPP13-like protein 1	37.331%	Swiss-Prot	weak database homology
`Q9LRR5`	Arabidopsis thaliana	Putative disease resistance protein At3g14460	34.100%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card