LXL04_005443 | RubberDandelionOmics

Gene overview

LXL04_005443

Reference: OH-1004 Chr: Chr01 Coordinates: 164242659-164243955 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

988 bp · LXL04_005443|LXL04_005443|OH1004|cDNA

ATCAAAGATTTCATCAAGGGCCACAATGAAATAGGAAGTAGACAACTCGTTTCATTTCTTTATAATACTTTGTTATCCCCTTCTTCAGCGAGGGAAAATCTTCCCCCAAGGGTTTTGCTCGGTAACAAAAATGGCGACACTTGAATCACTTCCAATCTCATTCTCCCGTCTCTCATATTCTTCAAATCCGCCATTAATACTCCCCGCAAGATTAAAGTTTTCATGCCCCACTTTTACCCCCAAATTCCTCCACAAATCTC...

CDS

Download CDS FASTA

858 bp · LXL04_005443|LXL04_005443|OH1004|CDS

ATGGCGACACTTGAATCACTTCCAATCTCATTCTCCCGTCTCTCATATTCTTCAAATCCGCCATTAATACTCCCCGCAAGATTAAAGTTTTCATGCCCCACTTTTACCCCCAAATTCCTCCACAAATCTCATCCCTCTCCTCTTACCATTTCAAGAAACTTTCAACTATTCTCATCATCATCACCGGCAATTCAAGAGGTTTCGGTCGAAGAAACCGAGAAATCAGAAGAACCCCAGAAAGAAATTTTACAAAAGAGGCT...

Protein

Download Protein FASTA

285 aa · LXL04_005443|LXL04_005443|OH1004|PROTEIN

MATLESLPISFSRLSYSSNPPLILPARLKFSCPTFTPKFLHKSHPSPLTISRNFQLFSSSSPAIQEVSVEETEKSEEPQKEILQKRLFVLNLPWTFTVDDLKNLFSECGTIEDAEIIKRKKDGKSRGYAFVTMASTEDALSVIQKYDSHELMGRIIRVEFAKENKKPSSAPPPSIPGEKRYKLYVSNLAWRVRANNLREFFAELNPVSTRVVFESPEGRSAGYGFVTFANKEDAESAISTFNGKELLGREITLAFSERDA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005443`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005443

Location Chr01:164242659-164243955 (+)

Description Similar to 28 kDa ribonucleoprotein, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52380`	Could be involved in splicing and/or processing of chloroplast RNAs.	No verified direct reference in this release
`At4g24770`	Required for specific RNA editing events in chloroplasts and stabilizes specific chloroplast mRNAs.	Arabidopsis chloroplast RNA binding proteins CP31A and CP29A associate with large transcript pools and confer cold stress tolerance by influencing multiple chloroplast RNA processing steps.2012 · DOI: 10.1105/tpc.112.103002

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005443 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0045087 innate immune response Biological Process

GO:1901259 chloroplast rRNA processing Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G52380

nsy:104227036

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.954

Rank 1 · LXL04_005443 · OH-1004

Mitochondrion0.045

Rank 2 · LXL04_005443 · OH-1004

Nucleus0.040

Rank 3 · LXL04_005443 · OH-1004

Cytoplasm0.020

Rank 4 · LXL04_005443 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_005443 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_187-156 aa

PF13893.13RRM_589-165 aa

PF28441.1RRM_1192-158 aa

PF00076.29RRM_1183-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005443	`PF00076.29`	RRM_1	87	156	2.3e-38	130.6
LXL04_005443	`PF13893.13`	RRM_5	89	165	8.4e-09	35.9
LXL04_005443	`PF28441.1`	RRM_11	92	158	2e-09	38.4
LXL04_005443	`PF00076.29`	RRM_1	183	252	2.3e-38	130.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39061`	Arabidopsis thaliana	RNA-binding protein CP33, chloroplastic	32.883%	Swiss-Prot	moderate database homology
`Q04836`	Arabidopsis thaliana	31 kDa ribonucleoprotein, chloroplastic	35.204%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card