LXL04_005315 | RubberDandelionOmics

Gene overview

LXL04_005315

Reference: OH-1004 Chr: Chr01 Coordinates: 160288100-160290684 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1008 bp · LXL04_005315|LXL04_005315|OH1004|cDNA

ATGTCCATGACTGGATTCGACCTATCGTTCCGGCATCTCTGTTCTCCATACACCCCCTCGAGATTCGAATTTCCCACTCAaattcgccggaaaattcaCCATGGCTGCACCTGCACCGCTATTAAACCCGTCCTTTGTTCAACATCCGTATCTTCGACCGCCGTTTCTGATTCAAGGAATGCAGATGAGAATCATGTTAGCACTTCATATGGCAGGAGAATGATGATTTCTATGATCTCATTTCTTTTGCCTCTTCATGT...

CDS

Download CDS FASTA

1008 bp · LXL04_005315|LXL04_005315|OH1004|CDS

ATGTCCATGACTGGATTCGACCTATCGTTCCGGCATCTCTGTTCTCCATACACCCCCTCGAGATTCGAATTTCCCACTCAAATTCGCCGGAAAATTCACCATGGCTGCACCTGCACCGCTATTAAACCCGTCCTTTGTTCAACATCCGTATCTTCGACCGCCGTTTCTGATTCAAGGAATGCAGATGAGAATCATGTTAGCACTTCATATGGCAGGAGAATGATGATTTCTATGATCTCATTTCTTTTGCCTCTTCATGT...

Protein

Download Protein FASTA

335 aa · LXL04_005315|LXL04_005315|OH1004|PROTEIN

MSMTGFDLSFRHLCSPYTPSRFEFPTQIRRKIHHGCTCTAIKPVLCSTSVSSTAVSDSRNADENHVSTSYGRRMMISMISFLLPLHVPIQHSYANTPDDLLLLQEEIRKVLTKGKAAGVLRLVFHDAGTYDVNDNSGGMNGSICYELDRPENKGLKKSLKILLEAKKVVDETQSVSVSVSDVIAVAGAEAVSFCGGPQIPVRIGRLDSMVPDPEGKLPEETLDAFGLKQSFKRKGFSTQELVALSGAHTLGSKGFGDPFI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005315`
TK1151 ID	TkA01G067110
OH-1004 ID	LXL04_005315
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005315

Location Chr01:160288100-160290684 (-)

Description Similar to APX6: Putative L-ascorbate peroxidase 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32320`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release
`At3g09640`	Plays a key role in hydrogen peroxide removal.	Control of Ascorbate Peroxidase 2 expression by hydrogen peroxide and leaf water status during excess light stress reveals a functional organisation of Arabidopsis leaves.2003 · DOI: 10.1046/j.1365-313x.2003.01656.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0549100`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005315 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009845 seed germination Biological Process

GO:0010431 seed maturation Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005778 peroxisomal membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004601 peroxidase activity Molecular Function

GO:0016688 L-ascorbate peroxidase activity Molecular Function

KEGG gene cross-reference

ath:AT3G09640

ath:AT4G32320

cnb:CNBE3880

dosa:Os08g0549100

mgr:MGG_10368

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.867

Rank 1 · LXL04_005315 · OH-1004

Mitochondrion0.140

Rank 2 · LXL04_005315 · OH-1004

Nucleus0.020

Rank 3 · LXL04_005315 · OH-1004

Cytoplasm0.019

Rank 4 · LXL04_005315 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_005315 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141.29peroxidase106-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005315	`PF00141.29`	peroxidase	106	309	1.9e-41	143.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY91`	Arabidopsis thaliana	Putative L-ascorbate peroxidase 6	67.910%	Swiss-Prot	strong database homology
`Q1PER6`	Arabidopsis thaliana	L-ascorbate peroxidase 2, cytosolic	39.640%	Swiss-Prot	moderate database homology
`Q6ZJJ1`	Oryza sativa subsp. japonica	Probable L-ascorbate peroxidase 4, peroxisomal	38.528%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card