LXL04_005223 | RubberDandelionOmics

Gene overview

LXL04_005223

Reference: OH-1004 Chr: Chr01 Coordinates: 158019425-158021041 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1290 bp · LXL04_005223|LXL04_005223|OH1004|cDNA

ATGGCTGTTTTCAGGAGCCCAACGTGCTCTCTGTTGGCGATTTTCATCGTTTTTGTAGGACACGTCGGCGCCTCGAACTATGTCCGGCCTCCGGCAGGCAGGTCTCTTTCTGTTTCACTATCTGAGGATCTTACTCCAACTTCTTCTCAACAGGTGCACATTTCGTTGGCGGGTAATGCCAATATGAGAGTATCGTGGGTTACAAAAGACATGATGACTCCATCAACCGTAAAATACGGTAAATCTCAAGGATTATACGA...

CDS

Download CDS FASTA

1290 bp · LXL04_005223|LXL04_005223|OH1004|CDS

ATGGCTGTTTTCAGGAGCCCAACGTGCTCTCTGTTGGCGATTTTCATCGTTTTTGTAGGACACGTCGGCGCCTCGAACTATGTCCGGCCTCCGGCAGGCAGGTCTCTTTCTGTTTCACTATCTGAGGATCTTACTCCAACTTCTTCTCAACAGGTGCACATTTCGTTGGCGGGTAATGCCAATATGAGAGTATCGTGGGTTACAAAAGACATGATGACTCCATCAACCGTAAAATACGGTAAATCTCAAGGATTATACGA...

Protein

Download Protein FASTA

429 aa · LXL04_005223|LXL04_005223|OH1004|PROTEIN

MAVFRSPTCSLLAIFIVFVGHVGASNYVRPPAGRSLSVSLSEDLTPTSSQQVHISLAGNANMRVSWVTKDMMTPSTVKYGKSQGLYDDSKTGTSSSYKYTVYKSGQIHDVVIGPLEPNTTYYYKCGHDSSPEFTFKTPPAQFPIDFAVSGDLGQTDWTKSTLERIAKIGYDVLLLPGDLSYADFYQPYWDSFARLVEPLASQRPWMVTQGNHEVERIPYFHKERFTAYNARWHMPYEESGSNSNLFYSFDVAGVHVIMLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005223`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005223

Location Chr01:158019425-158021041 (-)

Description Similar to PAP20: Probable purple acid phosphatase 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52780`	Probable purple acid phosphatase 20.	No verified direct reference in this release
`At3g52820`	Purple acid phosphatase 22.	No verified direct reference in this release
`At3g20500`	Purple acid phosphatase 18.	No verified direct reference in this release
`At3g52810`	Purple acid phosphatase 21.	No verified direct reference in this release
`At5g34850`	Metallo-phosphoesterase involved in phosphate metabolism.	Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and seedlings.2006 · DOI: 10.1104/pp.106.087171

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005223 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0051174 regulation of phosphorus metabolic process Biological Process

GO:0055062 phosphate ion homeostasis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009536 plastid Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0140825 lactoperoxidase activity Molecular Function

KEGG gene cross-reference

ath:AT3G20500

ath:AT3G52780

ath:AT3G52810

ath:AT3G52820

ath:AT5G34850

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.338

Rank 1 · LXL04_005223 · OH-1004

Extracellular0.332

Rank 2 · LXL04_005223 · OH-1004

Cell membrane0.146

Rank 3 · LXL04_005223 · OH-1004

Cytoplasm0.121

Rank 4 · LXL04_005223 · OH-1004

Endoplasmic reticulum0.092

Rank 5 · LXL04_005223 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16656.12Pur_ac_phosph_N50-137 aa

PF00149.34Metallophos146-338 aa

PF14008.12Metallophos_C353-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005223	`PF16656.12`	Pur_ac_phosph_N	50	137	1.5e-23	83.9
LXL04_005223	`PF00149.34`	Metallophos	146	338	6.3e-21	76.4
LXL04_005223	`PF14008.12`	Metallophos_C	353	411	2.1e-21	77.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXI7`	Arabidopsis thaliana	Probable purple acid phosphatase 20	65.412%	Swiss-Prot	strong database homology
`Q8S340`	Arabidopsis thaliana	Purple acid phosphatase 22	61.658%	Swiss-Prot	strong database homology
`Q9LJU7`	Arabidopsis thaliana	Purple acid phosphatase 18	59.666%	Swiss-Prot	strong database homology
`Q9LXI4`	Arabidopsis thaliana	Purple acid phosphatase 21	57.108%	Swiss-Prot	strong database homology
`Q949Y3`	Arabidopsis thaliana	Bifunctional purple acid phosphatase 26	44.819%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card