LXL04_005189 | RubberDandelionOmics

Gene overview

LXL04_005189

Reference: OH-1004 Chr: Chr01 Coordinates: 157453800-157460288 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3609 bp · LXL04_005189|LXL04_005189|OH1004|cDNA

ATGTCGGTAATCGTATCCCACTCTGCAATCACTTCTACTCGCACTCTCTATTCGTCTTCTTCTACGAGCTTAGGCTTCGTTCGCTTTCTCTCTACCCAATTCATTCATCGTCCTCGCTTTATCGTCGCTTCTAGCAGCTCGGATTTGCACTCAATCATGCCGCGCCACCAGAAAAGGGGTGGTCGAACAGATCAAAGGTGGATTCAAAAGCCAAACAGTGGGAAAACGGATGGTCCATCTGATGCTACAGAGGTTAACTC...

CDS

Download CDS FASTA

3609 bp · LXL04_005189|LXL04_005189|OH1004|CDS

ATGTCGGTAATCGTATCCCACTCTGCAATCACTTCTACTCGCACTCTCTATTCGTCTTCTTCTACGAGCTTAGGCTTCGTTCGCTTTCTCTCTACCCAATTCATTCATCGTCCTCGCTTTATCGTCGCTTCTAGCAGCTCGGATTTGCACTCAATCATGCCGCGCCACCAGAAAAGGGGTGGTCGAACAGATCAAAGGTGGATTCAAAAGCCAAACAGTGGGAAAACGGATGGTCCATCTGATGCTACAGAGGTTAACTC...

Protein

Download Protein FASTA

1202 aa · LXL04_005189|LXL04_005189|OH1004|PROTEIN

MSVIVSHSAITSTRTLYSSSSTSLGFVRFLSTQFIHRPRFIVASSSSDLHSIMPRHQKRGGRTDQRWIQKPNSGKTDGPSDATEVNSTASTEAITNGAGKLAIAENSARSSVPVAQFGSISVENVAPLHGQSNEQSSQVSSRCSPVINTNSIHGKKYVYQPKSSYGTVSSATTVDSAKTTAAQTAALSNLFKKDLLENFNIDNSTYATAKIRATFYPKFENEKSDQEVRSRMIEMVSKGLATLEVSLKHSGSLFMYAGHE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005189`
TK1151 ID	TkA01G077370
OH-1004 ID	LXL04_005189
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005189

Location Chr01:157453800-157460288 (-)

Description Similar to RNL: tRNA ligase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07910`	Essential component of stress-response pathways entailing repair of RNA breaks with 2',3'-cyclic phosphate and 5'-OH ends.	Dual functions of yeast tRNA ligase in the unfolded protein response: unconventional cytoplasmic splicing of HAC1 pre-mRNA is not sufficient to release translational attenuation.2010 · DOI: 10.1091/mbc.e10-08-0693

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005189 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006388 tRNA splicing, via endonucleolytic cleavage and ligation Biological Process

GO:0006412 translation Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010928 regulation of auxin mediated signaling pathway Biological Process

GO:0042245 RNA repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003972 RNA ligase (ATP) activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G07910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.432

Rank 1 · LXL04_005189 · OH-1004

Nucleus0.314

Rank 2 · LXL04_005189 · OH-1004

Plastid0.127

Rank 3 · LXL04_005189 · OH-1004

Mitochondrion0.099

Rank 4 · LXL04_005189 · OH-1004

Cell membrane0.090

Rank 5 · LXL04_005189 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WL81`	Arabidopsis thaliana	tRNA ligase 1	64.011%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card