LXL04_005182 | RubberDandelionOmics

Gene overview

LXL04_005182

Reference: OH-1004 Chr: Chr01 Coordinates: 157384381-157386630 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1550 bp · LXL04_005182|LXL04_005182|OH1004|cDNA

AGGTTTTCGTCTTTGGATCATTTACAGAGGATGAAATAAAATCCCTGCAAACGACCCCAAAACAGAATGATGTAGAATATATGTTTGGTTCTTTGGACTCTGCAACCCTAAGATCTGCAGGCATCTTCAACAACAAACCAAATGTTCCAGAAACCTCCAAAAACCACCAACAACCATCAAATCCAGCAAACAAAAACAACATACCAAAACCATCACAAAACCTTGTCTCAGATGTAAGTAAAAAAGAAAACATCAATGGT...

CDS

Download CDS FASTA

1506 bp · LXL04_005182|LXL04_005182|OH1004|CDS

CTGCAAACGACCCCAAAACAGAATGATGTAGAATATATGTTTGGTTCTTTGGACTCTGCAACCCTAAGATCTGCAGGCATCTTCAACAACAAACCAAATGTTCCAGAAACCTCCAAAAACCACCAACAACCATCAAATCCAGCAAACAAAAACAACATACCAAAACCATCACAAAACCTTGTCTCAGATGTAAGTAAAAAAGAAAACATCAATGGTTCATCTTCAAGCTCTCTTTTCTACACCAATGTTGTAAAAGAACA...

Protein

Download Protein FASTA

501 aa · LXL04_005182|LXL04_005182|OH1004|PROTEIN

MQTTPKQNDVEYMFGSLDSATLRSAGIFNNKPNVPETSKNHQQPSNPANKNNIPKPSQNLVSDVSKKENINGSSSSSLFYTNVVKEQEPKNVQQLPVSSVPEGIETEALVNPFEALDLINTKNTPVVSSNGLHSPPKELLPRGLVNSGNLCFLNATLQALLACSPFVHLLQELRIRNIPKIGYPTLHAFVEFISGFDMPPGIHSKKKDDIFLETGKPLRPIMFESVLNNFTPDMPNSFSGRPRQEDAQEFLSFVMHQMHD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005182`
TK1151 ID	TkA01G077630
OH-1004 ID	LXL04_005182
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 96.346 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005182

Location Chr01:157384381-157386630 (+)

Description Similar to UBP24: Ubiquitin carboxyl-terminal hydrolase 24

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g30890`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005182 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006508 proteolysis Biological Process

GO:0006914 autophagy Biological Process

GO:0006974 DNA damage response Biological Process

GO:0010506 regulation of autophagy Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0035520 monoubiquitinated protein deubiquitination Biological Process

GO:0043124 negative regulation of canonical NF-kappaB signal transduction Biological Process

GO:0045087 innate immune response Biological Process

GO:0062030 negative regulation of stress granule assembly Biological Process

GO:0071347 cellular response to interleukin-1 Biological Process

KEGG gene cross-reference

ath:AT4G30890

gga:415817

rno:307905

xla:380335

xla:779202

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.616

Rank 1 · LXL04_005182 · OH-1004

Nucleus0.404

Rank 2 · LXL04_005182 · OH-1004

Cell membrane0.077

Rank 3 · LXL04_005182 · OH-1004

Golgi apparatus0.071

Rank 4 · LXL04_005182 · OH-1004

Endoplasmic reticulum0.063

Rank 5 · LXL04_005182 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00443.36UCH142-498 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005182	`PF00443.36`	UCH	142	498	2.9e-45	155.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FPS3`	Arabidopsis thaliana	Ubiquitin carboxyl-terminal hydrolase 24	65.395%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card