LXL04_005116 | RubberDandelionOmics

Gene overview

LXL04_005116

Reference: OH-1004 Chr: Chr01 Coordinates: 155303854-155304942 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

717 bp · LXL04_005116|LXL04_005116|OH1004|cDNA

ATGTCGATTCAAGATCCAGGATTCTTGCGTAGAGGGCCTTGGCTAGATGAAGAAGACAACAGATTGACTACCACTGTTGGGGAATTAGGTGAAAAACATTGGGATGCTTTGGCTAAATCATCAGGTTTGAGGAGAAGTGGAAAAAGTTGTCGGCTCAGGTGGAAGAATTATCTTCGACCGAATTTAAAGCATGGTGATATCACACATGAAGAAGAACACACCATTCTTAATCTTCAGAAACAATGGGGCAACAAGTGGTC...

CDS

Download CDS FASTA

717 bp · LXL04_005116|LXL04_005116|OH1004|CDS

ATGTCGATTCAAGATCCAGGATTCTTGCGTAGAGGGCCTTGGCTAGATGAAGAAGACAACAGATTGACTACCACTGTTGGGGAATTAGGTGAAAAACATTGGGATGCTTTGGCTAAATCATCAGGTTTGAGGAGAAGTGGAAAAAGTTGTCGGCTCAGGTGGAAGAATTATCTTCGACCGAATTTAAAGCATGGTGATATCACACATGAAGAAGAACACACCATTCTTAATCTTCAGAAACAATGGGGCAACAAGTGGTC...

Protein

Download Protein FASTA

238 aa · LXL04_005116|LXL04_005116|OH1004|PROTEIN

MSIQDPGFLRRGPWLDEEDNRLTTTVGELGEKHWDALAKSSGLRRSGKSCRLRWKNYLRPNLKHGDITHEEEHTILNLQKQWGNKWSRIAKRLPGRTDNEIKNYWRSHLKGKAEAQQECLKGIEEDMKQDFMTPKCDRISFDHVGESSMSDKEDFFGISSSGTTEQYCDMNALGSGSPYESRMSDLISSCCWQSDEIKHHEEYGMGMFPCFSEIGSSFEEESKTHGVWDLWSPIWELG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005116`
TK1151 ID	TkA01G079830
OH-1004 ID	LXL04_005116
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005116

Location Chr01:155303854-155304942 (-)

Description Similar to MYB27: Transcription factor MYB27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53200`	Transcription factor MYB27.	No verified direct reference in this release
`At5g59780`	Transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0700500`	Transcription factor.	No verified direct reference in this release
`Os12g0567300`	Transcription factor.	No verified direct reference in this release
`Os11g0684000`	Jasmonate- (JA-) responsive transcription factor that promotes AGO18, AGO1a and AGO1b expression by binding to AG-motif-like elements in their promoters.	A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death.2001 · DOI: 10.1094/mpmi.2001.14.4.527 Jasmonate Signaling Enhances RNA Silencing and Antiviral Defense in Rice.2020 · DOI: 10.1016/j.chom.2020.05.001

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005116 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0035865 cellular response to potassium ion Biological Process

GO:0043266 regulation of potassium ion transport Biological Process

GO:0051607 defense response to virus Biological Process

GO:0098586 cellular response to virus Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT3G53200

ath:AT5G59780

dosa:Os11g0684000

dosa:Os11g0700500

dosa:Os12g0567300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.964

Rank 1 · LXL04_005116 · OH-1004

Cytoplasm0.110

Rank 2 · LXL04_005116 · OH-1004

Cell membrane0.023

Rank 3 · LXL04_005116 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_005116 · OH-1004

Mitochondrion0.012

Rank 5 · LXL04_005116 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249.38Myb_DNA-binding11-58 aa

PF13921.13Myb_DNA-bind_614-73 aa

PF00249.38Myb_DNA-binding65-109 aa

PF13921.13Myb_DNA-bind_668-113 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005116	`PF00249.38`	Myb_DNA-binding	11	58	9.1e-29	100.0
LXL04_005116	`PF13921.13`	Myb_DNA-bind_6	14	73	3e-18	66.5
LXL04_005116	`PF00249.38`	Myb_DNA-binding	65	109	9.1e-29	100.0
LXL04_005116	`PF13921.13`	Myb_DNA-bind_6	68	113	3e-18	66.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCP1`	Arabidopsis thaliana	Transcription factor MYB27	46.262%	Swiss-Prot	moderate database homology
`Q4JL84`	Arabidopsis thaliana	Transcription factor MYB59	54.955%	Swiss-Prot	weak database homology
`Q53NK6`	Oryza sativa subsp. japonica	Myb-related protein MYBAS1	59.633%	Swiss-Prot	weak database homology
`Q4JL76`	Oryza sativa subsp. japonica	Myb-related protein MYBAS2	59.633%	Swiss-Prot	weak database homology
`Q2QZJ8`	Oryza sativa subsp. japonica	Transcription factor JAMYB	48.000%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card