Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1707 bp · LXL04_005040|LXL04_005040|OH1004|cDNA
ATGGAGGCAGCAGCAAGCAATATGCTTTCGTCATCCTTATCTTTGCCCCCACGAACCCAATTCAAGCAAtctcctcctcctccttcaGCTTTAAAATTCTATGAGCCTTCTGCTCCTACACATTCGTCTATGTTAGCAACTTCTTTAGCGCAACATTTCCCTACTTCCGTCCTAATTCAAGAACAACGCCGGGAAAGCAAGCCATTATTGCAGACAATAAAAGACGATAAAACATCACAGGCAACATCGGATACCGAACA...
1707 bp · LXL04_005040|LXL04_005040|OH1004|CDS
ATGGAGGCAGCAGCAAGCAATATGCTTTCGTCATCCTTATCTTTGCCCCCACGAACCCAATTCAAGCAATCTCCTCCTCCTCCTTCAGCTTTAAAATTCTATGAGCCTTCTGCTCCTACACATTCGTCTATGTTAGCAACTTCTTTAGCGCAACATTTCCCTACTTCCGTCCTAATTCAAGAACAACGCCGGGAAAGCAAGCCATTATTGCAGACAATAAAAGACGATAAAACATCACAGGCAACATCGGATACCGAACA...
Protein
Download Protein FASTA568 aa · LXL04_005040|LXL04_005040|OH1004|PROTEIN
MEAAASNMLSSSLSLPPRTQFKQSPPPPSALKFYEPSAPTHSSMLATSLAQHFPTSVLIQEQRRESKPLLQTIKDDKTSQATSDTEQVGVDFSTHQVDATSCDEYLKEFQCRLLQWPGLWYMLPSSNTRDKTLSPLTTQPIPNGKGKHMDVNMEQVLALAKKALSASKEAASLVDDGESLGVDLDNSITSSLGSIHSNELQTGKVKFVKSTRIHERQSKRRKGTKSNVIVRETTGSTKPELEKKTSYKDSNLHDPLRMFL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_005040 |
|---|---|
| TK1151 ID | TkA01G083200 |
| OH-1004 ID | LXL04_005040 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 97.636 / OH-1004 94.542Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_005040 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:153417412-153420440 (+) | |||||||||
| Description | Similar to SIGF: RNA polymerase sigma factor sigF, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006352 DNA-templated transcription initiation Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006399 tRNA metabolic process Biological Process GO:0009658 chloroplast organization Biological Process GO:0010114 response to red light Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0071482 cellular response to light stimulus Biological Process GO:0071483 cellular response to blue light Biological Process GO:0090351 seedling development Biological Process GO:2001141 regulation of RNA biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0009507 chloroplast Cellular Component | |||||||||
| KEGG gene cross-reference | ana:all5263 ath:AT1G08540 ath:AT2G36990 syf:Synpcc7942_0649 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04542.21Sigma70_r2334-400 aaPF04539.23Sigma70_r3412-485 aaPF04545.23Sigma70_r4500-553 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_005040 | PF04542.21 | Sigma70_r2 | 334 | 400 | 4.7e-19 | 68.6 |
| LXL04_005040 | PF04539.23 | Sigma70_r3 | 412 | 485 | 4.3e-15 | 56.3 |
| LXL04_005040 | PF04545.23 | Sigma70_r4 | 500 | 553 | 5.7e-15 | 55.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.