LXL04_004807 | RubberDandelionOmics

Gene overview

LXL04_004807

Reference: OH-1004 Chr: Chr01 Coordinates: 147123834-147134140 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5691 bp · LXL04_004807|LXL04_004807|OH1004|cDNA

atgccaactgacgtatggctacaacacatttctgaagctcagaaaATCCCAGACTACCCGTGCAATCTGACCGTTGCTGCATATAATGGTGGGTTCTTGGAGAACTTCGGTGTTTCCGCCGGAGTTGTGTTACGGGGCGCCATGCTCATCAATCTTTCTTGGCCTAtgctatcatcatcatcatcatcatctcttcGCATTCTCTCTTTCCCTCCTCCACTTCGTTACAGTTTCATAAATCAGCCGTTACAGACTTACAG...

CDS

Download CDS FASTA

5691 bp · LXL04_004807|LXL04_004807|OH1004|CDS

ATGCCAACTGACGTATGGCTACAACACATTTCTGAAGCTCAGAAAATCCCAGACTACCCGTGCAATCTGACCGTTGCTGCATATAATGGTGGGTTCTTGGAGAACTTCGGTGTTTCCGCCGGAGTTGTGTTACGGGGCGCCATGCTCATCAATCTTTCTTGGCCTATGCTATCATCATCATCATCATCATCTCTTCGCATTCTCTCTTTCCCTCCTCCACTTCGTTACAGTTTCATAAATCAGCCGTTACAGACTTACAG...

Protein

Download Protein FASTA

1896 aa · LXL04_004807|LXL04_004807|OH1004|PROTEIN

MPTDVWLQHISEAQKIPDYPCNLTVAAYNGGFLENFGVSAGVVLRGAMLINLSWPMLSSSSSSSLRILSFPPPLRYSFINQPLQTYSTAISSIPTRAARMGHEKSQLISQTSHALANFRLCNVSGRKTELVEIHARDPKFHVLFIPGNPGVVSFYTDFLESLYEQMGETASITAAIGHISHSEKENRIQAQTESITALKTEMNQNHDKGVMDESSDAFVFSILETPKTIPQGAGSSGATTPTHGGPSLGGYRGSGDTKGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004807`
TK1151 ID	TkA01G109620
OH-1004 ID	LXL04_004807
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 61.853 / OH-1004 11.973 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_004807`
Location	Chr01:147123834-147134140 (-)
Description	Similar to TY3B-I: Transposon Ty3-I Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004807` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003887 DNA-directed DNA polymerase activity Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function
KEGG gene cross-reference	sce:YGR109W-B sce:YIL082W-A spo:2538755 spo:2541833 spo:2541991 spo:3361422 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.378

Rank 1 · LXL04_004807 · OH-1004

Cytoplasm0.246

Rank 2 · LXL04_004807 · OH-1004

Nucleus0.140

Rank 3 · LXL04_004807 · OH-1004

Peroxisome0.139

Rank 4 · LXL04_004807 · OH-1004

Plastid0.088

Rank 5 · LXL04_004807 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10230.16LIDHydrolase139-196 aa

PF03732.25PEG10_N-capsid287-358 aa

PF19259.5Ty3_capsid316-452 aa

PF30901.1PEG10-RTL1_C-capsid373-438 aa

PF08284.17RVP_2579-662 aa

PF30863.1PRO_PEG10-RTL1581-678 aa

PF00078.33RVT_1812-972 aa

PF17919.8RT_RNaseH_21034-1128 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004807	`PF10230.16`	LIDHydrolase	139	196	1.2e-59	202.9
LXL04_004807	`PF03732.25`	PEG10_N-capsid	287	358	6.9e-10	39.9
LXL04_004807	`PF19259.5`	Ty3_capsid	316	452	1.4e-07	31.9
LXL04_004807	`PF30901.1`	PEG10-RTL1_C-capsid	373	438	1.8e-07	31.8
LXL04_004807	`PF08284.17`	RVP_2	579	662	6.4e-12	46.2
LXL04_004807	`PF30863.1`	PRO_PEG10-RTL1	581	678	6.3e-08	33.7
LXL04_004807	`PF00078.33`	RVT_1	812	972	3.4e-43	148.6
LXL04_004807	`PF17919.8`	RT_RNaseH_2	1034	1128	6.6e-32	110.3
LXL04_004807	`PF17917.8`	RT_RNaseH	1059	1158	2.6e-28	99.0
LXL04_004807	`PF17921.8`	Integrase_H2C2	1248	1302	4.6e-19	69.0
LXL04_004807	`PF00665.33`	rve	1317	1416	3.2e-06	28.0
LXL04_004807	`PF10230.16`	LIDHydrolase	1671	1873	1.2e-59	202.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card