Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1521 bp · LXL04_004800|LXL04_004800|OH1004|cDNA
ATGGCACCATGGATTCTTCTCATGTTCCGCTCATTACTAATTTTGCTAGCAACTCCCTCATCTTTTGCAAAGTTTCCATCTAGGTACTTTCCTTCTTCAATTATCCACCCCGAAACACCATCTCTTTCTAGCAATACCAACTTGCTTTACAAAACAAGATACTTCACCCAAATTCTTGATCACTTCAATTACAATCCACAAAGTTACCAAACCTTCCAACAACGTTATCTGATCAATGACACATTCTGGGGCGGCCGCAA...
1521 bp · LXL04_004800|LXL04_004800|OH1004|CDS
ATGGCACCATGGATTCTTCTCATGTTCCGCTCATTACTAATTTTGCTAGCAACTCCCTCATCTTTTGCAAAGTTTCCATCTAGGTACTTTCCTTCTTCAATTATCCACCCCGAAACACCATCTCTTTCTAGCAATACCAACTTGCTTTACAAAACAAGATACTTCACCCAAATTCTTGATCACTTCAATTACAATCCACAAAGTTACCAAACCTTCCAACAACGTTATCTGATCAATGACACATTCTGGGGCGGCCGCAA...
Protein
Download Protein FASTA506 aa · LXL04_004800|LXL04_004800|OH1004|PROTEIN
MAPWILLMFRSLLILLATPSSFAKFPSRYFPSSIIHPETPSLSSNTNLLYKTRYFTQILDHFNYNPQSYQTFQQRYLINDTFWGGRKSKSPIFVYTGNEGNIEWFAQNTGFMYDIAPKFKALLIFLEHRYYGKSIPYGGNRKKAYKNSKNLGYLSSTQALADYATLILDLKNNLTTMDSPVIVFGGSYGGMLAAWFRLKYPHVAIGALASSAPILQFENITSQYSFNNIITQDFKSESENCYKVIKGSWKQIEDTATSKG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_004800 |
|---|---|
| TK1151 ID | TkA01G110030 |
| OH-1004 ID | LXL04_004800 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 53.953Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_004800 |
|---|---|
| Location | Chr01:147026752-147034288 (+) |
| Description | Similar to PRCP: Lysosomal Pro-X carboxypeptidase |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0002003 angiotensin maturation Biological Process GO:0002155 regulation of thyroid hormone receptor signaling pathway Biological Process GO:0003085 negative regulation of systemic arterial blood pressure Biological Process GO:0006508 proteolysis Biological Process GO:0030163 protein catabolic process Biological Process GO:0042593 glucose homeostasis Biological Process GO:0043535 regulation of blood vessel endothelial cell migration Biological Process GO:0097009 energy homeostasis Biological Process GO:1905146 lysosomal protein catabolic process Biological Process GO:2000377 regulation of reactive oxygen species metabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005764 lysosome Cellular Component |
| KEGG gene cross-reference | bta:534927 hsa:5547 mmu:72461 pon:100172335 rno:83799 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF05577.19Peptidase_S2857-485 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_004800 | PF05577.19 | Peptidase_S28 | 57 | 485 | 2.2e-86 | 291.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.