LXL04_004625 | RubberDandelionOmics

Gene overview

LXL04_004625

Reference: OH-1004 Chr: Chr01 Coordinates: 141810305-141812804 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1593 bp · LXL04_004625|LXL04_004625|OH1004|cDNA

ATGTTTTACGGCCACATGATTCCGATGGCTGACATGGCCGTTCTCTTCGCCTCCCGCGGCCTAAAAACCACCATAATCACCACCCCAACAATTGCGCCTCGCTTCTCTAAATCAATCCAGAAAACCATTAACCACCATCACCAAATCGCTCTCCTTATTATCCAATTCAAAAACATAGAAGCCGGTTTACCCGCCGGAAGTGAGAACCCCGATCAACGCCATTACGATGAGTCCTTATCCAATTTCTTACAAGCCCTTTC...

CDS

Download CDS FASTA

1593 bp · LXL04_004625|LXL04_004625|OH1004|CDS

ATGTTTTACGGCCACATGATTCCGATGGCTGACATGGCCGTTCTCTTCGCCTCCCGCGGCCTAAAAACCACCATAATCACCACCCCAACAATTGCGCCTCGCTTCTCTAAATCAATCCAGAAAACCATTAACCACCATCACCAAATCGCTCTCCTTATTATCCAATTCAAAAACATAGAAGCCGGTTTACCCGCCGGAAGTGAGAACCCCGATCAACGCCATTACGATGAGTCCTTATCCAATTTCTTACAAGCCCTTTC...

Protein

Download Protein FASTA

530 aa · LXL04_004625|LXL04_004625|OH1004|PROTEIN

MFYGHMIPMADMAVLFASRGLKTTIITTPTIAPRFSKSIQKTINHHHQIALLIIQFKNIEAGLPAGSENPDQRHYDESLSNFLQALSILQEPVEQFIRESRPNCIIADMFYPWSTDLAAKFNIPRIVFNGSGFFSHCVGNAAKNVSSDSEHFIVPHLPHEIKLTRKQLPDWQADAFKGFVKVLIESMEADAKSYGMIFNSFYELEPEYVHHYREVMNRKGWHIGPVSLCNTEDKWERGKKPVIDEHECLKWMESKAPDSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004625`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004625

Location Chr01:141810305-141812804 (+)

Description Similar to TOGT1: Scopoletin glucosyltransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34131`	Possesses quercetin 3-O-glucosyltransferase activity in vitro.	Pathogen-responsive expression of glycosyltransferase genes UGT73B3 and UGT73B5 is necessary for resistance to Pseudomonas syringae pv tomato in Arabidopsis.2005 · DOI: 10.1104/pp.105.067223

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004625 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0016104 triterpenoid biosynthetic process Biological Process

GO:0016135 saponin biosynthetic process Biological Process

GO:0051555 flavonol biosynthetic process Biological Process

GO:0051707 response to other organism Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0009507 chloroplast Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0035251 UDP-glucosyltransferase activity Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0047893 flavonol 3-O-glucosyltransferase activity Molecular Function

GO:0050275 scopoletin glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G34131

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.774

Rank 1 · LXL04_004625 · OH-1004

Nucleus0.217

Rank 2 · LXL04_004625 · OH-1004

Endoplasmic reticulum0.068

Rank 3 · LXL04_004625 · OH-1004

Peroxisome0.054

Rank 4 · LXL04_004625 · OH-1004

Cell membrane0.050

Rank 5 · LXL04_004625 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168.1Glyco_transf_N4-226 aa

PF00201.25UDPGT248-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004625	`PF26168.1`	Glyco_transf_N	4	226	1.8e-07	32.0
LXL04_004625	`PF00201.25`	UDPGT	248	365	3.4e-22	79.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W491`	Arabidopsis thaliana	UDP-glycosyltransferase 73B3	46.358%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card