LXL04_004517 | RubberDandelionOmics

Gene overview

LXL04_004517

Reference: OH-1004 Chr: Chr01 Coordinates: 139022691-139024031 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1341 bp · LXL04_004517|LXL04_004517|OH1004|cDNA

ATGGCGGTGGACACAGTTGATTCTAATTTAACAAGGAGGAGGAGCTCTAGAAGGTCGCAAACAACCATGCCTGTAACTCCGACTCGATCATCAAGTAATTCCGAAACACATCTTCATCCATCATCGAGTAATGTTACAGGTAGTAGCTACAGCTACGGAGGTGGCACCGGCTCGAGTTACAGACTCGACAGCTCAATCGCAACCGCTGAAGCGTCCGTTTCCTCCAGAACATCGCTGACCAGCCTCCGTAACTCGTTGCC...

CDS

Download CDS FASTA

1341 bp · LXL04_004517|LXL04_004517|OH1004|CDS

ATGGCGGTGGACACAGTTGATTCTAATTTAACAAGGAGGAGGAGCTCTAGAAGGTCGCAAACAACCATGCCTGTAACTCCGACTCGATCATCAAGTAATTCCGAAACACATCTTCATCCATCATCGAGTAATGTTACAGGTAGTAGCTACAGCTACGGAGGTGGCACCGGCTCGAGTTACAGACTCGACAGCTCAATCGCAACCGCTGAAGCGTCCGTTTCCTCCAGAACATCGCTGACCAGCCTCCGTAACTCGTTGCC...

Protein

Download Protein FASTA

446 aa · LXL04_004517|LXL04_004517|OH1004|PROTEIN

MAVDTVDSNLTRRRSSRRSQTTMPVTPTRSSSNSETHLHPSSSNVTGSSYSYGGGTGSSYRLDSSIATAEASVSSRTSLTSLRNSLPENTHIYEFSEIRSATNNFLAKKLSSSSSPSWRCSLRGKEVVVFQRKFRRPIQESELREKLSVIYRSHHMSIIKLLGASISGDYIYLAYDFMSGGNLADCLRNKRNPEFTVLSTWMSRMQIATDLASGLDYIHNNAGLKINLVHKYVKSSSVIVTEPSFNAKICHFGTAELCGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004517`
TK1151 ID	TkA01G138980
OH-1004 ID	LXL04_004517
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.891 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004517

Location Chr01:139022691-139024031 (+)

Description Similar to LYK3: LysM domain receptor-like kinase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51940`	Putative Lysin motif (LysM) receptor kinase that may recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands.	No verified direct reference in this release
`At1g01540`	Probable serine/threonine-protein kinase At1g01540.	No verified direct reference in this release
`At3g17420`	Probable receptor-like protein kinase At3g17420.	No verified direct reference in this release
`At5g48740`	Probable LRR receptor-like serine/threonine-protein kinase At5g48740.	No verified direct reference in this release
`At2g19230`	Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g19230.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004517 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G01540

ath:AT1G51940

ath:AT2G19230

ath:AT3G17420

ath:AT5G48740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.604

Rank 1 · LXL04_004517 · OH-1004

Nucleus0.300

Rank 2 · LXL04_004517 · OH-1004

Cytoplasm0.287

Rank 3 · LXL04_004517 · OH-1004

Endoplasmic reticulum0.033

Rank 4 · LXL04_004517 · OH-1004

Golgi apparatus0.024

Rank 5 · LXL04_004517 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase136-416 aa

PF07714.24PK_Tyr_Ser-Thr137-258 aa

PF07714.24PK_Tyr_Ser-Thr303-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004517	`PF00069.32`	Pkinase	136	416	4.9e-22	79.3
LXL04_004517	`PF07714.24`	PK_Tyr_Ser-Thr	137	258	6.2e-23	82.1
LXL04_004517	`PF07714.24`	PK_Tyr_Ser-Thr	303	418	6.2e-23	82.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IB81`	Arabidopsis thaliana	LysM domain receptor-like kinase 3	31.054%	Swiss-Prot	moderate database homology
`Q3EDL4`	Arabidopsis thaliana	Probable serine/threonine-protein kinase At1g01540	29.167%	Swiss-Prot	weak database homology
`Q9LRP3`	Arabidopsis thaliana	Probable receptor-like protein kinase At3g17420	25.635%	Swiss-Prot	weak database homology
`C0LGV0`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At5g48740	29.586%	Swiss-Prot	weak database homology
`O64556`	Arabidopsis thaliana	Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g19230	28.198%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card