LXL04_004398 | RubberDandelionOmics

Gene overview

LXL04_004398

Reference: OH-1004 Chr: Chr01 Coordinates: 134647630-134650176 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1248 bp · LXL04_004398|LXL04_004398|OH1004|cDNA

ATGGCCGGCCACCGTGCCCCGGTCAACTCCAACGACGTTTTGGAAACTCCGGTGTTAGACGTTGTGGCACACAGCCTCCTCCAAAGCATATCTGAAGAAGGTGGTTATGCATATGTGAGTATGTCAACACGCGCCGCTGCTGGAGACATACGAGCCGCGGAGGCGGCGCGTGAGGTGGCGTGGGAGCAGCTTCACTCCGGTCCATGGCACTCTGTGTTGCCAGTGTGGAGAGACGCGTACTCGATGGCGTGTTTGCACGT...

CDS

Download CDS FASTA

1248 bp · LXL04_004398|LXL04_004398|OH1004|CDS

ATGGCCGGCCACCGTGCCCCGGTCAACTCCAACGACGTTTTGGAAACTCCGGTGTTAGACGTTGTGGCACACAGCCTCCTCCAAAGCATATCTGAAGAAGGTGGTTATGCATATGTGAGTATGTCAACACGCGCCGCTGCTGGAGACATACGAGCCGCGGAGGCGGCGCGTGAGGTGGCGTGGGAGCAGCTTCACTCCGGTCCATGGCACTCTGTGTTGCCAGTGTGGAGAGACGCGTACTCGATGGCGTGTTTGCACGT...

Protein

Download Protein FASTA

415 aa · LXL04_004398|LXL04_004398|OH1004|PROTEIN

MAGHRAPVNSNDVLETPVLDVVAHSLLQSISEEGGYAYVSMSTRAAAGDIRAAEAAREVAWEQLHSGPWHSVLPVWRDAYSMACLHVAKFQYANGEFKEALRVLDMGLIMGGMVLRKDLESAVEKATERANALLRVSEESDNGSANANLVTNQNAINLIETLQILPKNSLSSKHVGKRSSLSLEGFMNDHFLPGSPVLLTDSMTHWPAITKWNDLNYLKKVAGYRTVPVEVGKNYLCNDWKQEMLTFSDFLERIESNSCD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004398`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004398

Location Chr01:134647630-134650176 (+)

Description Similar to JMJ30: Lysine-specific demethylase JMJ30

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20810`	Histone demethylase that demethylates 'Lys-36' (H3K36me) of histone H3 with a specific activity for H3K36me3 and H3K36me2.	Jumonji domain protein JMJD5 functions in both the plant and human circadian systems.2010 · DOI: 10.1073/pnas.1014204108 The Jumonji C domain-containing protein JMJ30 regulates period length in the Arabidopsis circadian clock.2011 · DOI: 10.1104/pp.110.167015 JMJD5 Functions in concert with TOC1 in the arabidopsis circadian system.2011 · DOI: 10.4161/psb.6.3.14654 A MYB-domain protein EFM mediates flowering responses to environmental cues in Arabidopsis.2014 · DOI: 10.1016/j.devcel.2014.07.004 Jumonji demethylases moderate precocious flowering at elevated temperature via regulation of FLC in Arabidopsis.2014 · DOI: 10.1038/ncomms6098 JMJ30-mediated demethylation of H3K9me3 drives tissue identity changes to promote callus formation in Arabidopsis.2018 · DOI: 10.1111/tpj.14002 Arabidopsis JMJD5/JMJ30 Acts Independently of LUX ARRHYTHMO Within the Plant Circadian Clock to Enable Temperature Compensation.2019 · DOI: 10.3389/fpls.2019.00057 Abscisic acid-dependent histone demethylation during postgermination growth arrest in Arabidopsis.2019 · DOI: 10.1111/pce.13547 Histone demethylases control root elongation in response to stress-signaling hormone abscisic acid.2019 · DOI: 10.1080/15592324.2019.1604019 Histone Demethylases Coordinate the Antagonistic Interaction Between Abscisic Acid and Brassinosteroid Signaling in Arabidopsis .2020 · DOI: 10.3389/fpls.2020.596835

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004398 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000086 G2/M transition of mitotic cell cycle Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006508 proteolysis Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0010378 temperature compensation of the circadian clock Biological Process

KEGG gene cross-reference

ath:AT3G20810

hsa:79831

mmu:77035

rno:308976

xtr:100158649

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.589

Rank 1 · LXL04_004398 · OH-1004

Cytoplasm0.583

Rank 2 · LXL04_004398 · OH-1004

Mitochondrion0.055

Rank 3 · LXL04_004398 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_004398 · OH-1004

Cell membrane0.040

Rank 5 · LXL04_004398 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24472.2ARM_KDM8_N16-137 aa

PF13621.13Cupin_8186-413 aa

PF08007.19JmjC_2303-410 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004398	`PF24472.2`	ARM_KDM8_N	16	137	2.6e-64	215.5
LXL04_004398	`PF13621.13`	Cupin_8	186	413	5.3e-47	161.6
LXL04_004398	`PF08007.19`	JmjC_2	303	410	1.1e-10	41.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWR1`	Arabidopsis thaliana	Lysine-specific demethylase JMJ30	65.707%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card