LXL04_004261 | RubberDandelionOmics

Gene overview

LXL04_004261

Reference: OH-1004 Chr: Chr01 Coordinates: 131390059-131391433 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

714 bp · LXL04_004261|LXL04_004261|OH1004|cDNA

ATGGAGTTCTGGGAAACCTATACAAATGATAAACTTATACAATATCAACTGAATCCAATCCAAAGTTCGCATCCCCTGCTCCTCGTAAGCGACGAACCAAGGGATCTTTCTCCTCGATTAGGGATGGAGGAGCAGTTTGTACTGAGAGTGCCTCCTTCTGTTGCCGAGCGTATAGATCTCCTTTTAAACGAGAGTGCCGACCAGTCACTCGATTTGTCCTTCTCTGAAGATGGGAGGAGTGGCACATTTGTTATAGGCGA...

CDS

Download CDS FASTA

714 bp · LXL04_004261|LXL04_004261|OH1004|CDS

ATGGAGTTCTGGGAAACCTATACAAATGATAAACTTATACAATATCAACTGAATCCAATCCAAAGTTCGCATCCCCTGCTCCTCGTAAGCGACGAACCAAGGGATCTTTCTCCTCGATTAGGGATGGAGGAGCAGTTTGTACTGAGAGTGCCTCCTTCTGTTGCCGAGCGTATAGATCTCCTTTTAAACGAGAGTGCCGACCAGTCACTCGATTTGTCCTTCTCTGAAGATGGGAGGAGTGGCACATTTGTTATAGGCGA...

Protein

Download Protein FASTA

237 aa · LXL04_004261|LXL04_004261|OH1004|PROTEIN

MEFWETYTNDKLIQYQLNPIQSSHPLLLVSDEPRDLSPRLGMEEQFVLRVPPSVAERIDLLLNESADQSLDLSFSEDGRSGTFVIGDDQFPASLLDLPSILESYKTYDDNVLIKTADIGQMIMVREDRDPAPDGIEYRHGVTPPMRDARRRRFRREPDLNPELVQRVEKDLLNIMNGGTAIDILIFAHMEMTEQDEVGEGSGRNTMKKAVAVPAAKPDVINAGEPERSDSDESDYSI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004261`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004261

Location Chr01:131390059-131391433 (-)

Description Similar to TAF7: Transcription initiation factor TFIID subunit 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55300`	TAFs are components of the transcription factor IID (TFIID) complex that is essential for mediating regulation of RNA polymerase transcription.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004261 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000296 spermine transport Biological Process

GO:0006282 regulation of DNA repair Biological Process

GO:0006352 DNA-templated transcription initiation Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006367 transcription initiation at RNA polymerase II promoter Biological Process

GO:0006469 negative regulation of protein kinase activity Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0030154 cell differentiation Biological Process

GO:0030520 estrogen receptor signaling pathway Biological Process

GO:0042789 mRNA transcription by RNA polymerase II Biological Process

KEGG gene cross-reference

ath:AT1G55300

cge:100689466

dme:Dmel_CG2670

hsa:54457

mmu:24074

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.862

Rank 1 · LXL04_004261 · OH-1004

Cytoplasm0.287

Rank 2 · LXL04_004261 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_004261 · OH-1004

Mitochondrion0.022

Rank 4 · LXL04_004261 · OH-1004

Endoplasmic reticulum0.018

Rank 5 · LXL04_004261 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04658.19TAFII55_N42-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004261	`PF04658.19`	TAFII55_N	42	175	1.2e-31	110.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9DG24`	Arabidopsis thaliana	Transcription initiation factor TFIID subunit 7	71.613%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card