LXL04_004253 | RubberDandelionOmics

Gene overview

LXL04_004253

Reference: OH-1004 Chr: Chr01 Coordinates: 131146489-131148074 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_004253|LXL04_004253|OH1004|cDNA

ATGTCGACTTTGACACTTCCTCCGGTACATCCTCATCCCCGCGACGATGCCCTGCAATTATATAAAGCTTTCAAAGGATTCGGATGTGATACTGAGGCTGTGATCAGGATTCTTGCTCACCGAGATGCAACACAACGGGCATATATCCAGCAAGAATATCGGATGACATATGGGGAAGAGTTATCTAAGCGTTTGGTTTCTGAACTTAAAGGGAAATTAGAGACTGCAGTTCTGCTTTGGATTCATGATCCAGCGGGAAG...

CDS

Download CDS FASTA

948 bp · LXL04_004253|LXL04_004253|OH1004|CDS

ATGTCGACTTTGACACTTCCTCCGGTACATCCTCATCCCCGCGACGATGCCCTGCAATTATATAAAGCTTTCAAAGGATTCGGATGTGATACTGAGGCTGTGATCAGGATTCTTGCTCACCGAGATGCAACACAACGGGCATATATCCAGCAAGAATATCGGATGACATATGGGGAAGAGTTATCTAAGCGTTTGGTTTCTGAACTTAAAGGGAAATTAGAGACTGCAGTTCTGCTTTGGATTCATGATCCAGCGGGAAG...

Protein

Download Protein FASTA

315 aa · LXL04_004253|LXL04_004253|OH1004|PROTEIN

MSTLTLPPVHPHPRDDALQLYKAFKGFGCDTEAVIRILAHRDATQRAYIQQEYRMTYGEELSKRLVSELKGKLETAVLLWIHDPAGRDAEILRQGLSTSIDLVAVTEVLCSRTPSQLQHLKQLYHSKFGVYLEHDIQQQTSGDHQKMLLAWVTTPRHEGMEVNTETAAKDAKLLYKAGEKKLGTDEKTFVHIFSERSSAHLAAVSLYYHDMYGHALKKAVKKEASGYFQQALLTIVQCADHPAKHFAKVLHKSMKGLGTN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004253`
TK1151 ID	TkA01G177750
OH-1004 ID	LXL04_004253
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004253

Location Chr01:131146489-131148074 (+)

Description Similar to ANN5: Annexin D5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68090`	Annexin D5.	No verified direct reference in this release
`At5g65020`	May mediate regulated, targeted secretion of Golgi-derived vesicles during seedling development.	No verified direct reference in this release
`At5g10230`	Annexin D7.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004253 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009555 pollen development Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0015774 polysaccharide transport Biological Process

GO:0030154 cell differentiation Biological Process

GO:0042997 negative regulation of Golgi to plasma membrane protein transport Biological Process

GO:0042998 positive regulation of Golgi to plasma membrane protein transport Biological Process

KEGG gene cross-reference

ath:AT1G68090

ath:AT5G65020

hsa:312

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.606

Rank 1 · LXL04_004253 · OH-1004

Cell membrane0.310

Rank 2 · LXL04_004253 · OH-1004

Nucleus0.228

Rank 3 · LXL04_004253 · OH-1004

Mitochondrion0.091

Rank 4 · LXL04_004253 · OH-1004

Extracellular0.082

Rank 5 · LXL04_004253 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00191.26Annexin16-79 aa

PF00191.26Annexin87-151 aa

PF00191.26Annexin170-235 aa

PF00191.26Annexin246-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004253	`PF00191.26`	Annexin	16	79	1.6e-79	262.6
LXL04_004253	`PF00191.26`	Annexin	87	151	1.6e-79	262.6
LXL04_004253	`PF00191.26`	Annexin	170	235	1.6e-79	262.6
LXL04_004253	`PF00191.26`	Annexin	246	310	1.6e-79	262.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9X3`	Arabidopsis thaliana	Annexin D5	50.476%	Swiss-Prot	strong database homology
`Q9XEE2`	Arabidopsis thaliana	Annexin D2	40.823%	Swiss-Prot	moderate database homology
`Q9LX07`	Arabidopsis thaliana	Annexin D7	38.535%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card