LXL04_004091 | RubberDandelionOmics

Gene overview

LXL04_004091

Reference: OH-1004 Chr: Chr01 Coordinates: 124829027-124834701 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2436 bp · LXL04_004091|LXL04_004091|OH1004|cDNA

ATGAAGCGTTATATGCAACCATTAAACCCTATAAATCTTCTACCCGAAAACAGAAACATTCCAACGAAAATGCTCCACCTCCAGACAGCAACGCCATTTCAGATTCATTTATACAGGGAAACCATCTCCCGTTCTGCCTGTAAATTGAAATCGCCACTCCCACCAAGACCTCCTCCGTCTAGTTCTCTCAAGCGGAAGCTTAGTAATGAATTGCCTCTGGAAAATGGTGTTGCTGGATCTTCGGATACAGGAGTGAAGGT...

CDS

Download CDS FASTA

2436 bp · LXL04_004091|LXL04_004091|OH1004|CDS

ATGAAGCGTTATATGCAACCATTAAACCCTATAAATCTTCTACCCGAAAACAGAAACATTCCAACGAAAATGCTCCACCTCCAGACAGCAACGCCATTTCAGATTCATTTATACAGGGAAACCATCTCCCGTTCTGCCTGTAAATTGAAATCGCCACTCCCACCAAGACCTCCTCCGTCTAGTTCTCTCAAGCGGAAGCTTAGTAATGAATTGCCTCTGGAAAATGGTGTTGCTGGATCTTCGGATACAGGAGTGAAGGT...

Protein

Download Protein FASTA

811 aa · LXL04_004091|LXL04_004091|OH1004|PROTEIN

MKRYMQPLNPINLLPENRNIPTKMLHLQTATPFQIHLYRETISRSACKLKSPLPPRPPPSSSLKRKLSNELPLENGVAGSSDTGVKVIVRMRPPRKNEEEGEIIVQKTSGDSLSILRQPFTFDSIGKPAPVSSKESSAAGKDDDEEWDDLDLRAASAIRLSLAKNVLANVHGISTAKELWEKLEQLYQGKGISNRLYLKEQFHTLRMNGDTKISDHLSVLNNIVSELEAIGVKVEDEDKALRLILSLPSSYEHMKPILMY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004091`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004091

Location Chr01:124829027-124834701 (-)

Description Similar to KIN12A: Kinesin-like protein KIN-12A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14150`	Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.	Identification of a phragmoplast-associated kinesin-related protein in higher plants.2000 · DOI: 10.1016/s0960-9822(00)00564-9 Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis.2007 · DOI: 10.1105/tpc.107.050716
`At3g23670`	Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.	Two Arabidopsis phragmoplast-associated kinesins play a critical role in cytokinesis during male gametogenesis.2007 · DOI: 10.1105/tpc.107.050716
`At3g19050`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0350300`	Plus-end directed kinesin-like motor enzyme that plays a critical role in the organization of phragmoplast microtubules during cytokinesis.	No verified direct reference in this release
`Os02g0489800`	Kinesin-like protein KIN-12B.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004091 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0007112 male meiosis cytokinesis Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0080175 phragmoplast microtubule organization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT3G23670

ath:AT4G14150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.477

Rank 1 · LXL04_004091 · OH-1004

Cytoplasm0.462

Rank 2 · LXL04_004091 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_004091 · OH-1004

Mitochondrion0.064

Rank 4 · LXL04_004091 · OH-1004

Endoplasmic reticulum0.047

Rank 5 · LXL04_004091 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223.15Retrotran_gag_2135-283 aa

PF00225.30Kinesin297-572 aa

PF16796.12Microtub_bd318-392 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004091	`PF14223.15`	Retrotran_gag_2	135	283	1.2e-33	116.9
LXL04_004091	`PF00225.30`	Kinesin	297	572	5.6e-84	282.6
LXL04_004091	`PF16796.12`	Microtub_bd	318	392	1e-08	35.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LDN0`	Arabidopsis thaliana	Kinesin-like protein KIN-12A	75.000%	Swiss-Prot	weak database homology
`Q8L7Y8`	Arabidopsis thaliana	Kinesin-like protein KIN-12B	73.754%	Swiss-Prot	weak database homology
`Q27IK6`	Arabidopsis thaliana	Kinesin-like protein KIN-12D	38.899%	Swiss-Prot	moderate database homology
`Q7XKR9`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-12A	68.543%	Swiss-Prot	weak database homology
`Q6K765`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-12B	69.307%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card