LXL04_003672 | RubberDandelionOmics

Gene overview

LXL04_003672

Reference: OH-1004 Chr: Chr01 Coordinates: 93270186-93272432 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1933 bp · LXL04_003672|LXL04_003672|OH1004|cDNA

ATGACGTGCTTCCTTCTAAACCAGAAAAAAGCCGTTGTTTGGCACCCGGTCATCGTCGTTATCGAGGAACCAAAAAGAGGACTCACAGACACGATTTTCTTGTTTTCCCTCTTCACTGAAACCCTCACCAACAACTTCAATGGAGGTTCATATGCATACTCGATCGCCTTACCATCTTACTCTTATATTCCCCAAAAGCAGTATTAAGATCTCCACGAAGTTCccttttcttcttcaaaccTCAACCACCTCCCGTCGAC...

CDS

Download CDS FASTA

1899 bp · LXL04_003672|LXL04_003672|OH1004|CDS

TTGTTTGGCACCCGGTCATCGTCGTTATCGAGGAACCAAAAAGAGGACTCACAGACACGATTTTCTTGTTTTCCCTCTTCACTGAAACCCTCACCAACAACTTCAATGGAGGTTCATATGCATACTCGATCGCCTTACCATCTTACTCTTATATTCCCCAAAAGCAGTATTAAGATCTCCACGAAGTTCCCTTTTCTTCTTCAAACCTCAACCACCTCCCGTCGACTTCACTACACATCCTTGTTCGTCGCCGCAACCAG...

Protein

Download Protein FASTA

632 aa · LXL04_003672|LXL04_003672|OH1004|PROTEIN

MFGTRSSSLSRNQKEDSQTRFSCFPSSLKPSPTTSMEVHMHTRSPYHLTLIFPKSSIKISTKFPFLLQTSTTSRRLHYTSLFVAATRAPLPLPLPLPPTSVVPLEQPGGKMVVELVGTFNELTERMKNNNNQLLSTSSSRLLFKTLKLCLPILQTLPLAPDGRSPLSRALSAAILLADLQMDAEVISVGILREALEANAISMYQVKDRIGISTAHLLHETLRVKNMASKVDIYDEETTSALRKFCLTYYDVRALILDLAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003672`
TK1151 ID	TkA01G323230
OH-1004 ID	LXL04_003672
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 94.712 / OH-1004 96.361 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003672

Location Chr01:93270186-93272432 (-)

Description Similar to CRSH: Probable GTP diphosphokinase CRSH, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17470`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	The bacterial stringent response, conserved in chloroplasts, controls plant fertilization.2008 · DOI: 10.1093/pcp/pcm177 Expression profiling of four RelA/SpoT-like proteins, homologues of bacterial stringent factors, in Arabidopsis thaliana.2008 · DOI: 10.1007/s00425-008-0758-5
`UniProt: Q9M5P5`	Probable ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase that may be involved in a rapid plant ppGpp-mediated response to pathogens and other stresses.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0161200`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	Calcium-activated (p)ppGpp synthetase in chloroplasts of land plants.2007 · DOI: 10.1074/jbc.m703820200
`Os05g0161800`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	Calcium-activated (p)ppGpp synthetase in chloroplasts of land plants.2007 · DOI: 10.1074/jbc.m703820200
`Os05g0161500`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	Calcium-activated (p)ppGpp synthetase in chloroplasts of land plants.2007 · DOI: 10.1074/jbc.m703820200

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003672 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015969 guanosine tetraphosphate metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005509 calcium ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0008728 GTP diphosphokinase activity Molecular Function

GO:0016301 kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G17470

dosa:Os05g0161200

dosa:Os05g0161500

dosa:Os05g0161800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.950

Rank 1 · LXL04_003672 · OH-1004

Mitochondrion0.058

Rank 2 · LXL04_003672 · OH-1004

Nucleus0.030

Rank 3 · LXL04_003672 · OH-1004

Cytoplasm0.026

Rank 4 · LXL04_003672 · OH-1004

Cell membrane0.016

Rank 5 · LXL04_003672 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13328.13HD_4159-296 aa

PF04607.24RelA_SpoT362-487 aa

PF13202.13EF-hand_5528-551 aa

PF00036.39EF-hand_1530-553 aa

PF13499.13EF-hand_7530-581 aa

PF13405.13EF-hand_6530-555 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003672	`PF13328.13`	HD_4	159	296	1.1e-20	74.6
LXL04_003672	`PF04607.24`	RelA_SpoT	362	487	1.5e-28	100.0
LXL04_003672	`PF13202.13`	EF-hand_5	528	551	5.5e-10	39.0
LXL04_003672	`PF00036.39`	EF-hand_1	530	553	8.3e-12	44.5
LXL04_003672	`PF13499.13`	EF-hand_7	530	581	5.7e-11	43.3
LXL04_003672	`PF13405.13`	EF-hand_6	530	555	1.1e-08	34.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84R11`	Arabidopsis thaliana	Probable GTP diphosphokinase CRSH, chloroplastic	66.542%	Swiss-Prot	strong database homology
`Q9M5P5`	Arabidopsis thaliana	Probable GTP diphosphokinase RSH3, chloroplastic	34.835%	Swiss-Prot	moderate database homology
`Q6ATB4`	Oryza sativa subsp. japonica	GTP diphosphokinase CRSH1, chloroplastic	60.721%	Swiss-Prot	strong database homology
`Q75IS2`	Oryza sativa subsp. japonica	GTP diphosphokinase CRSH3, chloroplastic	52.651%	Swiss-Prot	strong database homology
`Q6ATB2`	Oryza sativa subsp. japonica	GTP diphosphokinase CRSH2, chloroplastic	51.455%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card