LXL04_003429 | RubberDandelionOmics

Gene overview

LXL04_003429

Reference: OH-1004 Chr: Chr01 Coordinates: 78916865-78921992 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2121 bp · LXL04_003429|LXL04_003429|OH1004|cDNA

ATGCTAGAACATGCAAGGGTGAGGTTGGTGGCAGTCAAGGTAGGGGTGGTGGCAGTCAATATAGAGATGGTGGCAGTCAAGGTGGTGTTAGACAAAAAAAATGTTCTGGCCTCCTCCTTCAATTTATCCAATGCGCTCTTAACCCTCTTCATTGATCTCAACAAGCCAGGAATCATAGTCTTTGACATTTCACACAATGGACCATCGATCCATCCGATAAATCCACATGTTGAATGCTtggaaaagaaaaaaagaagaaa...

CDS

Download CDS FASTA

2121 bp · LXL04_003429|LXL04_003429|OH1004|CDS

ATGCTAGAACATGCAAGGGTGAGGTTGGTGGCAGTCAAGGTAGGGGTGGTGGCAGTCAATATAGAGATGGTGGCAGTCAAGGTGGTGTTAGACAAAAAAAATGTTCTGGCCTCCTCCTTCAATTTATCCAATGCGCTCTTAACCCTCTTCATTGATCTCAACAAGCCAGGAATCATAGTCTTTGACATTTCACACAATGGACCATCGATCCATCCGATAAATCCACATGTTGAATGCTTGGAAAAGAAAAAAAGAAGAAA...

Protein

Download Protein FASTA

706 aa · LXL04_003429|LXL04_003429|OH1004|PROTEIN

MLEHARVRLVAVKVGVVAVNIEMVAVKVVLDKKNVLASSFNLSNALLTLFIDLNKPGIIVFDISHNGPSIHPINPHVECLEKKKRRKTKHTKLELKTSKSKSSNSYRLRTPPEMSTRVDISPRVCFEKARVDVKENFMVSSHTKHQWKGKVRTPIEAKNTNEDSENPTGFFFPLSYKTIRNNRTPPTTKSHPLFSLSLFPFLSGRSFGPAMAPPSTAINRTASDGGTIILNKYQLTRLLGRGSFAKVYHGRSLIDDSSVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003429`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003429

Location Chr01:78916865-78921992 (+)

Description Similar to CIPK7: CBL-interacting serine/threonine-protein kinase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23000`	CIPK serine-threonine protein kinases interact with CBL proteins.	CIPK7 is involved in cold response by interacting with CBL1 in Arabidopsis thaliana.2011 · DOI: 10.1016/j.plantsci.2011.03.011
`At4g14580`	CIPK serine-threonine protein kinases interact with CBL proteins.	No verified direct reference in this release
`At5g01810`	CIPK serine-threonine protein kinases interact with CBL proteins.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0634400`	CIPK serine-threonine protein kinases interact with CBL proteins.	No verified direct reference in this release
`Os01g0206700`	CIPK serine-threonine protein kinases interact with CBL proteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003429 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009413 response to flooding Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G23000

ath:AT4G14580

ath:AT5G01810

dosa:Os01g0206700

dosa:Os03g0634400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.454

Rank 1 · LXL04_003429 · OH-1004

Cytoplasm0.429

Rank 2 · LXL04_003429 · OH-1004

Cell membrane0.159

Rank 3 · LXL04_003429 · OH-1004

Endoplasmic reticulum0.073

Rank 4 · LXL04_003429 · OH-1004

Golgi apparatus0.037

Rank 5 · LXL04_003429 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase233-487 aa

PF07714.24PK_Tyr_Ser-Thr234-482 aa

PF03109.23ABC1303-380 aa

PF03822.21NAF518-572 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003429	`PF00069.32`	Pkinase	233	487	6e-71	239.6
LXL04_003429	`PF07714.24`	PK_Tyr_Ser-Thr	234	482	4e-38	131.9
LXL04_003429	`PF03109.23`	ABC1	303	380	1.1e-07	32.0
LXL04_003429	`PF03822.21`	NAF	518	572	3e-18	66.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIW0`	Arabidopsis thaliana	CBL-interacting serine/threonine-protein kinase 7	60.158%	Swiss-Prot	moderate database homology
`Q9SUL7`	Arabidopsis thaliana	CBL-interacting serine/threonine-protein kinase 4	57.105%	Swiss-Prot	moderate database homology
`P92937`	Arabidopsis thaliana	CBL-interacting serine/threonine-protein kinase 15	48.077%	Swiss-Prot	moderate database homology
`Q75GK4`	Oryza sativa subsp. japonica	CBL-interacting protein kinase 7	50.962%	Swiss-Prot	moderate database homology
`Q9LWM4`	Oryza sativa subsp. japonica	CBL-interacting protein kinase 5	45.147%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card