LXL04_003298 | RubberDandelionOmics

Gene overview

LXL04_003298

Reference: OH-1004 Chr: Chr01 Coordinates: 74002583-74003662 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1080 bp · LXL04_003298|LXL04_003298|OH1004|cDNA

acgaaaaacaaacccaatCCCTCTCCAGCTCCCCAGAAGAAACAAGCATTAACCGCCTTCGCGGCCACAACACCAGCCGACACCACTCCCCAAAAGCCTTATAATGGGACGCTCCCGAAATGTAATCGGTGCAATTTCCATCATGTCGGAGCATGTAAGGAGATGTTCTGTACGAACTGCAAGAAGacgggccacacggcccgattttgtaaaagtcctgcttcAGGACCTGTACAGGGAAACACTGCTGGGGCCATCAA...

CDS

Download CDS FASTA

918 bp · LXL04_003298|LXL04_003298|OH1004|CDS

ATGTTCTGTACGAACTGCAAGAAGACGGGCCACACGGCCCGATTTTGTAAAAGTCCTGCTTCAGGACCTGTACAGGGAAACACTGCTGGGGCCATCAAGGCCTGCTACGGTTGTGGGGATGTGGGGCATTTTAAAAGAAACTGCCCGAAAGCAGCGGGAACGGCGAACGGACGTGTGTTCGCCATGGGAGCTAAAGAAGCGCAGGAAGACCCACGATGCGTGACGGGTACGTTTCTGATCAACAACCGTTATGCTACTGT...

Protein

Download Protein FASTA

306 aa · LXL04_003298|LXL04_003298|OH1004|PROTEIN

MFCTNCKKTGHTARFCKSPASGPVQGNTAGAIKACYGCGDVGHFKRNCPKAAGTANGRVFAMGAKEAQEDPRCVTGTFLINNRYATVLFDSGAERSFINRKFRKLLTHESQTLNDTYIVAMANGQIESTKELLKNCSLTLNDHTFHVNLMPMTIGSFDVIIGMDWLEPHHADVMCYEKAIRLNLPNGDAMIVYGDKSCDNLRIISCIKAQKYLHKKCYAFLAHIVDKSKEPKKIQDIPQVCDFPDVFLEDLPGLPPNRQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003298`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003298

Location Chr01:74002583-74003662 (-)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g36020`	Chaperone that binds to RNA, single- (ssDNA) and double-stranded (dsDNA) DNA, and unwinds nucleic acid duplex.	Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Escherichia coli.2007 · DOI: 10.1093/nar/gkl1076 Cold shock domain proteins affect seed germination and growth of Arabidopsis thaliana under abiotic stress conditions.2009 · DOI: 10.1093/pcp/pcp037

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003298 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009631 cold acclimation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0003690 double-stranded DNA binding Molecular Function

GO:0003697 single-stranded DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G36020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.724

Rank 1 · LXL04_003298 · OH-1004

Nucleus0.280

Rank 2 · LXL04_003298 · OH-1004

Mitochondrion0.076

Rank 3 · LXL04_003298 · OH-1004

Cell membrane0.054

Rank 4 · LXL04_003298 · OH-1004

Endoplasmic reticulum0.054

Rank 5 · LXL04_003298 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00098.29zf-CCHC34-50 aa

PF08284.17RVP_256-183 aa

PF13975.12gag-asp_proteas79-167 aa

PF13650.12Asp_protease_280-165 aa

PF30863.1PRO_PEG10-RTL187-178 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003298	`PF00098.29`	zf-CCHC	34	50	6.1e-06	26.8
LXL04_003298	`PF08284.17`	RVP_2	56	183	7.9e-30	104.1
LXL04_003298	`PF13975.12`	gag-asp_proteas	79	167	3.5e-08	34.6
LXL04_003298	`PF13650.12`	Asp_protease_2	80	165	7.2e-06	27.3
LXL04_003298	`PF30863.1`	PRO_PEG10-RTL1	87	178	6.9e-11	43.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65639`	Arabidopsis thaliana	Cold shock protein 1	42.424%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card