LXL04_003086 | RubberDandelionOmics

Gene overview

LXL04_003086

Reference: OH-1004 Chr: Chr01 Coordinates: 67146777-67149986 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2253 bp · LXL04_003086|LXL04_003086|OH1004|cDNA

ATGCTCATGTCAAAATCGAAGAAGGTGAAAACCACCCCATCCTCAAAATCCGCTTTTACATCTTCTCATATCACCGACGATGACGACGATTTTCAGAACCCAACTCAATCATTACCACTCACCCAACGAAAACCTAGCTCCTCACAGCTAGTCAAACCCTCCAATGCCGCCATCAATCGACAACCCAAGAAGCCTAAAAAGAGTCATGCTAATCCCGGTAAGGAAAATCTCGAACTTCCACCTGATTTGGGGTTGGATTC...

CDS

Download CDS FASTA

2253 bp · LXL04_003086|LXL04_003086|OH1004|CDS

ATGCTCATGTCAAAATCGAAGAAGGTGAAAACCACCCCATCCTCAAAATCCGCTTTTACATCTTCTCATATCACCGACGATGACGACGATTTTCAGAACCCAACTCAATCATTACCACTCACCCAACGAAAACCTAGCTCCTCACAGCTAGTCAAACCCTCCAATGCCGCCATCAATCGACAACCCAAGAAGCCTAAAAAGAGTCATGCTAATCCCGGTAAGGAAAATCTCGAACTTCCACCTGATTTGGGGTTGGATTC...

Protein

Download Protein FASTA

750 aa · LXL04_003086|LXL04_003086|OH1004|PROTEIN

MLMSKSKKVKTTPSSKSAFTSSHITDDDDDFQNPTQSLPLTQRKPSSSQLVKPSNAAINRQPKKPKKSHANPGKENLELPPDLGLDSVLSLESMESTVFCSNKSDKSVSFTHDENETKSKDGSRYLSNSIESRLLSRSGGDCGLSVYENTSEKVDTHPEERVEDYQEAGTTQLDLLLDLCCSSEDEEINRDDNMDVVDVISCPLCGIDISDMTEELRHVHTNECLDKPQVHNHVDASNGDHLTESPGQVLDDSPSRSHGQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003086`
TK1151 ID	TkA01G395150
OH-1004 ID	LXL04_003086
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003086

Location Chr01:67146777-67149986 (-)

Description Similar to Dclre1a: DNA cross-link repair 1A protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26680`	May be required for repair of DNA lesions formed after exposure to oxidative stress.	SNM-dependent recombinational repair of oxidatively induced DNA damage in Arabidopsis thaliana.2004 · DOI: 10.1038/sj.embor.7400256

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003086 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0036297 interstrand cross-link repair Biological Process

GO:0051301 cell division Biological Process

GO:0001650 fibrillar center Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0003684 damaged DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0008800 beta-lactamase activity Molecular Function

GO:0035312 5'-3' DNA exonuclease activity Molecular Function

KEGG gene cross-reference

ath:AT3G26680

ddi:DDB_G0277755

gga:423902

hsa:9937

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.908

Rank 1 · LXL04_003086 · OH-1004

Cytoplasm0.153

Rank 2 · LXL04_003086 · OH-1004

Mitochondrion0.028

Rank 3 · LXL04_003086 · OH-1004

Cell membrane0.027

Rank 4 · LXL04_003086 · OH-1004

Endoplasmic reticulum0.017

Rank 5 · LXL04_003086 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00536.38SAM_1267-323 aa

PF07647.25SAM_2267-323 aa

PF12706.14Lactamase_B_2425-543 aa

PF07522.20DRMBL613-716 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003086	`PF00536.38`	SAM_1	267	323	9.9e-16	58.6
LXL04_003086	`PF07647.25`	SAM_2	267	323	8.7e-11	42.5
LXL04_003086	`PF12706.14`	Lactamase_B_2	425	543	1.5e-06	28.6
LXL04_003086	`PF07522.20`	DRMBL	613	716	1.6e-27	96.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38961`	Arabidopsis thaliana	DNA cross-link repair protein SNM1	44.277%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card