LXL04_002931 | RubberDandelionOmics

Gene overview

LXL04_002931

Reference: OH-1004 Chr: Chr01 Coordinates: 61474161-61475054 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

894 bp · LXL04_002931|LXL04_002931|OH1004|cDNA

atgtttttggaaaaaacaaacagaaccttaGTTCATCAGCTTTATTCCAACAAACCTTCTCCGACGAAGAGAAACGGCAGAAGTTTACGAGTCGCTTTTAGTTTTGGGATCAAAGGTACGTTCTTGGAGTACGTTGACCTTTCAAACAATCATATTTCAGGGAACATTCGTAGTACGATTTCGAATCTTAGGAATCTTGCAAGGATTGATGTTTCGAGGAATCGGATTACGGGAACAATTCCTCCAAGTTTGGGGATATT...

CDS

Download CDS FASTA

894 bp · LXL04_002931|LXL04_002931|OH1004|CDS

ATGTTTTTGGAAAAAACAAACAGAACCTTAGTTCATCAGCTTTATTCCAACAAACCTTCTCCGACGAAGAGAAACGGCAGAAGTTTACGAGTCGCTTTTAGTTTTGGGATCAAAGGTACGTTCTTGGAGTACGTTGACCTTTCAAACAATCATATTTCAGGGAACATTCGTAGTACGATTTCGAATCTTAGGAATCTTGCAAGGATTGATGTTTCGAGGAATCGGATTACGGGAACAATTCCTCCAAGTTTGGGGATATT...

Protein

Download Protein FASTA

297 aa · LXL04_002931|LXL04_002931|OH1004|PROTEIN

MFLEKTNRTLVHQLYSNKPSPTKRNGRSLRVAFSFGIKGTFLEYVDLSNNHISGNIRSTISNLRNLARIDVSRNRITGTIPPSLGILSKLGWLDISSNSIGGKIPTSLLVIKYLRHVNMKGNKLCGEIPQGRPLNVFPKAANVHNQTSTPTSSMEILHLSNLFLCNFKYISLEVVPVQYRELSRDGEQVIIVGDSITEEIIKPYCEHRIELPATEARTLIWEARVVGCEVSYGAEFVPSAENGYTVIVQKSRKFTESSDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002931`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002931

Location Chr01:61474161-61475054 (+)

Description Similar to PATL1: Patellin-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72150`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	Patellin1, a novel Sec14-like protein, localizes to the cell plate and binds phosphoinositides.2004 · DOI: 10.1104/pp.104.045369
`At1g22530`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	No verified direct reference in this release
`At4g09160`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	No verified direct reference in this release
`At1g72160`	Carrier protein that may be involved in membrane-trafficking events associated with cell plate formation during cytokinesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0809300`	Involved in plant defense response.	A novel simple extracellular leucine-rich repeat (eLRR) domain protein from rice (OsLRR1) enters the endosomal pathway and interacts with the hypersensitive-induced reaction protein 1 (OsHIR1).2009 · DOI: 10.1111/j.1365-3040.2009.02039.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002931 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0051301 cell division Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

GO:1901703 protein localization involved in auxin polar transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G22530

ath:AT1G72150

ath:AT1G72160

ath:AT4G09160

dosa:Os01g0809300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.304

Rank 1 · LXL04_002931 · OH-1004

Cytoplasm0.240

Rank 2 · LXL04_002931 · OH-1004

Cell membrane0.223

Rank 3 · LXL04_002931 · OH-1004

Endoplasmic reticulum0.163

Rank 4 · LXL04_002931 · OH-1004

Extracellular0.120

Rank 5 · LXL04_002931 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13855.13LRR_842-100 aa

PF12799.14LRR_442-77 aa

PF13855.13LRR_864-124 aa

PF25099.2GOLD_PATL1_C202-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002931	`PF13855.13`	LRR_8	42	100	1.7e-11	44.4
LXL04_002931	`PF12799.14`	LRR_4	42	77	2.4e-06	28.3
LXL04_002931	`PF13855.13`	LRR_8	64	124	1.7e-11	44.4
LXL04_002931	`PF25099.2`	GOLD_PATL1_C	202	285	5.6e-27	94.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56WK6`	Arabidopsis thaliana	Patellin-1	50.400%	Swiss-Prot	weak database homology
`Q56ZI2`	Arabidopsis thaliana	Patellin-2	49.600%	Swiss-Prot	weak database homology
`Q9M0R2`	Arabidopsis thaliana	Patellin-5	45.113%	Swiss-Prot	weak database homology
`Q56Z59`	Arabidopsis thaliana	Patellin-3	44.531%	Swiss-Prot	weak database homology
`Q5VQP7`	Oryza sativa subsp. japonica	Leucine-rich repeat protein 1	42.268%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card