LXL04_002828 | RubberDandelionOmics

Gene overview

LXL04_002828

Reference: OH-1004 Chr: Chr01 Coordinates: 58976189-58977179 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

921 bp · LXL04_002828|LXL04_002828|OH1004|cDNA

ATGGAAAATACACAAGAACCAGAGGAAAGCCAGATCCAAGAAACAGAAACCCGCGAGGCGATGCTTTCTAGGCACAGAAAAGAGATCACTCagttacaaaacaaggaaaTTGCCCTAAAAAAAGCAGCAGCTAAAGGCAGCAAAGCGGAGCAAAAAGCCAAAAAGAAACAAGTggaagaacaaatctcccaacTAACAACAGACCTAAAACAAAAACATCTAGCACAACTTGCTACAGTAGGCTATGCTAGTAATAACAC...

CDS

Download CDS FASTA

921 bp · LXL04_002828|LXL04_002828|OH1004|CDS

ATGGAAAATACACAAGAACCAGAGGAAAGCCAGATCCAAGAAACAGAAACCCGCGAGGCGATGCTTTCTAGGCACAGAAAAGAGATCACTCAGTTACAAAACAAGGAAATTGCCCTAAAAAAAGCAGCAGCTAAAGGCAGCAAAGCGGAGCAAAAAGCCAAAAAGAAACAAGTGGAAGAACAAATCTCCCAACTAACAACAGACCTAAAACAAAAACATCTAGCACAACTTGCTACAGTAGGCTATGCTAGTAATAACAC...

Protein

Download Protein FASTA

306 aa · LXL04_002828|LXL04_002828|OH1004|PROTEIN

MENTQEPEESQIQETETREAMLSRHRKEITQLQNKEIALKKAAAKGSKAEQKAKKKQVEEQISQLTTDLKQKHLAQLATVGYASNNTTIKEDNIDILAKAIAGVSVTHQPVYPKPTKSAKRKEKRAQEEAAREQRIQQEQSNIVSDKMVENEKLEKKLQPLGFTINEIKPDGHCLYRAVEHQLKTKSKSFYTFQELRKMVADYMRKNSADFLPFFLSETETDGDCHERFESYCNEVESTAAWGGQLELGALTHCLKKHIM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002828`
TK1151 ID	TkA01G418400
OH-1004 ID	LXL04_002828
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002828

Location Chr01:58976189-58977179 (-)

Description Similar to OTU5: OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62940`	Hydrolase that can remove conjugated ubiquitin from proteins in vitro and may therefore play an important regulatory role at the level of protein turnover by preventing degradation (Probable).	Distinct phylogenetic relationships and biochemical properties of Arabidopsis ovarian tumor-related deubiquitinases support their functional differentiation.2014 · DOI: 10.3389/fpls.2014.00084 The Deubiquitinase OTU5 Regulates Root Responses to Phosphate Starvation.2018 · DOI: 10.1104/pp.17.01525

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002828 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0017148 negative regulation of translation Biological Process

GO:0043248 proteasome assembly Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0140374 antiviral innate immune response Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004843 cysteine-type deubiquitinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G62940

dre:393194

hsa:51633

mmu:72201

xtr:496720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.621

Rank 1 · LXL04_002828 · OH-1004

Nucleus0.437

Rank 2 · LXL04_002828 · OH-1004

Mitochondrion0.092

Rank 3 · LXL04_002828 · OH-1004

Cell membrane0.064

Rank 4 · LXL04_002828 · OH-1004

Endoplasmic reticulum0.055

Rank 5 · LXL04_002828 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02338.26OTU169-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002828	`PF02338.26`	OTU	169	300	4.7e-33	115.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYC7`	Arabidopsis thaliana	OVARIAN TUMOR DOMAIN-containing deubiquitinating enzyme 5	67.208%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card