LXL04_002591 | RubberDandelionOmics

Gene overview

LXL04_002591

Reference: OH-1004 Chr: Chr01 Coordinates: 52541593-52552472 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

8034 bp · LXL04_002591|LXL04_002591|OH1004|cDNA

ATGGACTTTGTTTTCCGCCACACATCTGATCATACCCATCACCCGCCACCGGAACCGTCAACAAGCTCACCGACCTCACCTGCCCAGCCTCCACCACAACAACCATTTTCCCAAGAGGAGCCCGAGTACTTGGCTCGCTACCTTGTTGTTAAACACTCATGGCGTGGTCGGTACAAGAGGATACTTTGTATATCAAATTACACCCTAACAACTCTAGACCCTACGACATTATCAGTGACCAACTCTTACGACGTGAGCAA...

CDS

Download CDS FASTA

8034 bp · LXL04_002591|LXL04_002591|OH1004|CDS

ATGGACTTTGTTTTCCGCCACACATCTGATCATACCCATCACCCGCCACCGGAACCGTCAACAAGCTCACCGACCTCACCTGCCCAGCCTCCACCACAACAACCATTTTCCCAAGAGGAGCCCGAGTACTTGGCTCGCTACCTTGTTGTTAAACACTCATGGCGTGGTCGGTACAAGAGGATACTTTGTATATCAAATTACACCCTAACAACTCTAGACCCTACGACATTATCAGTGACCAACTCTTACGACGTGAGCAA...

Protein

Download Protein FASTA

2677 aa · LXL04_002591|LXL04_002591|OH1004|PROTEIN

MDFVFRHTSDHTHHPPPEPSTSSPTSPAQPPPQQPFSQEEPEYLARYLVVKHSWRGRYKRILCISNYTLTTLDPTTLSVTNSYDVSKDYEGASPVIGKDENTMEFTVSVRTDGRGKFKATKFSSRYRASILTELHRIRWNRLGTLGEFPVLHLRRKTAEWVPLTMKVTYVGVELTELKSGDLRWCLDFRDMASPAIILLSDAYGRKNSEPGGFVLCALYGRKCKAFQAAPGTSNSTIVGNLKKTAKSTVGVLLSVESSQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002591`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002591

Location Chr01:52541593-52552472 (+)

Description Similar to GRV2: DnaJ homolog subfamily C GRV2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26890`	Required for endosome formation, vacuolar protein sorting and determination of the embryo growth axis.	The gravitropism defective 2 mutants of Arabidopsis are deficient in a protein implicated in endocytosis in Caenorhabditis elegans.2004 · DOI: 10.1104/pp.104.050583 Arabidopsis KAM2/GRV2 is required for proper endosome formation and functions in vacuolar sorting and determination of the embryo growth axis.2007 · DOI: 10.1105/tpc.106.046631 Arabidopsis vacuolar sorting mutants (green fluorescent seed) can be identified efficiently by secretion of vacuole-targeted green fluorescent protein in their seeds.2007 · DOI: 10.1105/tpc.106.045997 The GRV2/RME-8 protein of Arabidopsis functions in the late endocytic pathway and is required for vacuolar membrane flow.2008 · DOI: 10.1111/j.1365-313x.2007.03314.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002591 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000578 embryonic axis specification Biological Process

GO:0006260 DNA replication Biological Process

GO:0006457 protein folding Biological Process

GO:0006623 protein targeting to vacuole Biological Process

GO:0006897 endocytosis Biological Process

GO:0006898 receptor-mediated endocytosis Biological Process

GO:0007032 endosome organization Biological Process

GO:0007033 vacuole organization Biological Process

GO:0009408 response to heat Biological Process

GO:0009638 phototropism Biological Process

GO:0009660 amyloplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

KEGG gene cross-reference

ath:AT2G26890

hsa:23317

pon:100174139

reh:H16_A3088

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512

Rank 1 · LXL04_002591 · OH-1004

Nucleus0.228

Rank 2 · LXL04_002591 · OH-1004

Golgi apparatus0.189

Rank 3 · LXL04_002591 · OH-1004

Cell membrane0.141

Rank 4 · LXL04_002591 · OH-1004

Endoplasmic reticulum0.113

Rank 5 · LXL04_002591 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19432.6RME-8_N46-138 aa

PF14237.12GYF_21173-1221 aa

PF00226.37DnaJ1537-1577 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002591	`PF19432.6`	RME-8_N	46	138	2.9e-20	73.3
LXL04_002591	`PF14237.12`	GYF_2	1173	1221	7.9e-14	51.9
LXL04_002591	`PF00226.37`	DnaJ	1537	1577	1.1e-10	42.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IVL6`	Arabidopsis thaliana	DnaJ homolog subfamily C GRV2	73.857%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card