LXL04_001920 | RubberDandelionOmics

Gene overview

LXL04_001920

Reference: OH-1004 Chr: Chr01 Coordinates: 36915051-36916594 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1263 bp · LXL04_001920|LXL04_001920|OH1004|cDNA

ATGGCGGAGAACGATGTAAAGGAAGTAGTTCAACAGAAGAATGACGATTCACCGAGAAAGGAGAAGAGGAGCATCTTATCTCGAATTTGGAACGGATTGATTAGATTACATGGTGATAATTTTGAGAAGAGATTGCAGCATTTATCCAAAGAAGAGGCAACTATTCTTGCTAGAATGAAGAAACGATCTAAGCGATGGCGGAGAACTGCTAGAAACATAATCGCATTTTCTGTTCTTCTCGAGAGTGTCGCAATTGGATA...

CDS

Download CDS FASTA

1263 bp · LXL04_001920|LXL04_001920|OH1004|CDS

ATGGCGGAGAACGATGTAAAGGAAGTAGTTCAACAGAAGAATGACGATTCACCGAGAAAGGAGAAGAGGAGCATCTTATCTCGAATTTGGAACGGATTGATTAGATTACATGGTGATAATTTTGAGAAGAGATTGCAGCATTTATCCAAAGAAGAGGCAACTATTCTTGCTAGAATGAAGAAACGATCTAAGCGATGGCGGAGAACTGCTAGAAACATAATCGCATTTTCTGTTCTTCTCGAGAGTGTCGCAATTGGATA...

Protein

Download Protein FASTA

420 aa · LXL04_001920|LXL04_001920|OH1004|PROTEIN

MAENDVKEVVQQKNDDSPRKEKRSILSRIWNGLIRLHGDNFEKRLQHLSKEEATILARMKKRSKRWRRTARNIIAFSVLLESVAIGYAIMTTRSVNLEWNIRAMRVLPMFVLPVLSWALYCGIRSFKTFCDQRDERSLERLREERQAKINELKDRTNYYNTQQLIQRYDSDPAAKAAAATVLASKLGAESGLQVSIDDSHLTGKSNDFEVLQSGGLRRRNTVEGRSPGSTCNSEKEGFQYAGSEVSEVSLPSELVVEHSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001920`
TK1151 ID	TkA01G498350
OH-1004 ID	LXL04_001920
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.700
Protein coverage (%)	TK1151 99.761 / OH-1004 99.762 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001920

Location Chr01:36915051-36916594 (+)

Description Similar to At2g24330: Uncharacterized protein At2g24330

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g24330`	Uncharacterized protein At2g24330.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001920 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0071784 endoplasmic reticulum cisternal network assembly Biological Process

GO:0071786 endoplasmic reticulum tubular network organization Biological Process

GO:0071788 endoplasmic reticulum tubular network maintenance Biological Process

GO:1903373 positive regulation of endoplasmic reticulum tubular network organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0071782 endoplasmic reticulum tubular network Cellular Component

GO:0097225 sperm midpiece Cellular Component

KEGG gene cross-reference

ath:AT2G24330

hsa:80856

mmu:69605

pon:100173134

tru:100125769

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.384

Rank 1 · LXL04_001920 · OH-1004

Golgi apparatus0.241

Rank 2 · LXL04_001920 · OH-1004

Nucleus0.196

Rank 3 · LXL04_001920 · OH-1004

Cytoplasm0.152

Rank 4 · LXL04_001920 · OH-1004

Cell membrane0.124

Rank 5 · LXL04_001920 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF31016.1Lunapark_N40-168 aa

PF10058.15Zn_ribbon_10270-320 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001920	`PF31016.1`	Lunapark_N	40	168	2e-09	38.3
LXL04_001920	`PF10058.15`	Zn_ribbon_10	270	320	1e-18	67.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQ34`	Arabidopsis thaliana	Uncharacterized protein At2g24330	49.223%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card