Gene Card
Gene overview
cDNA / CDS / Protein Sequences
462 bp · LXL04_001918|LXL04_001918|OH1004|cDNA
ATGGCGAACAGCAATCTACCTCGAAGAATTATCAAGGAAACTCAGCGGTTACTCAGCGAACCAGCTCCTGGGATAAGCGCATCGCCATCGGAAGATAACATGAGGTATTTCAATGTCATGATCCTTGGTCCTACACAATCTCCTTATGAAGGAGGCGTTTTCAAGCTGGAATTATTTTTGCCAGAAGAATATCCAATGGCTGCTCCCAAGGTTCGatttcttacaaaaatctaCCACCCCAACATTGACAAGCTTGGTAG...
462 bp · LXL04_001918|LXL04_001918|OH1004|CDS
ATGGCGAACAGCAATCTACCTCGAAGAATTATCAAGGAAACTCAGCGGTTACTCAGCGAACCAGCTCCTGGGATAAGCGCATCGCCATCGGAAGATAACATGAGGTATTTCAATGTCATGATCCTTGGTCCTACACAATCTCCTTATGAAGGAGGCGTTTTCAAGCTGGAATTATTTTTGCCAGAAGAATATCCAATGGCTGCTCCCAAGGTTCGATTTCTTACAAAAATCTACCACCCCAACATTGACAAGCTTGGTAG...
Protein
Download Protein FASTA153 aa · LXL04_001918|LXL04_001918|OH1004|PROTEIN
MANSNLPRRIIKETQRLLSEPAPGISASPSEDNMRYFNVMILGPTQSPYEGGVFKLELFLPEEYPMAAPKVRFLTKIYHPNIDKLGRICLDILKDKWSPALQIRTVLLSIQALLSAPNPDDPLSENIAKHWKSNEAEAVETAKEWTRLYASGA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_001918 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_001918 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:36877328-36878903 (+) | |||||||||
| Description | Similar to UBC35: Ubiquitin-conjugating enzyme E2 35 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000209 protein polyubiquitination Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0000729 DNA double-strand break processing Biological Process GO:0006281 DNA repair Biological Process GO:0006301 DNA damage tolerance Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0010039 response to iron ion Biological Process GO:0010053 root epidermal cell differentiation Biological Process GO:0016567 protein ubiquitination Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0045739 positive regulation of DNA repair Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G16890 ath:AT1G78870 mmu:93765 pon:100174607 rno:116725 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00179.32UQ_con9-145 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_001918 | PF00179.32 | UQ_con | 9 | 145 | 7.2e-51 | 172.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.