LXL04_001880 | RubberDandelionOmics

Gene overview

LXL04_001880

Reference: OH-1004 Chr: Chr01 Coordinates: 35866303-35867782 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

666 bp · LXL04_001880|LXL04_001880|OH1004|cDNA

ATGGCTGCTTCTATCAGTACCAGTCAACTAGGGTCTGCTTTTTTGGGCGAGCGGAATGGAATCTGCGTTTCAAGCGTTCCCGTCAGTCACCTCAGCTTCAGACGCAAAACAATCGAATGTAAAGAATCAAGAATCGGAAAACAACCAATCGAAGTCCCATCAAACGTAGTAATCACACTCGAAGGCCAAGATATGAAAGTAAAAGGTCCATTAGGCGAACTCGCACTTTCCTACCCACGAGAAATCGCAATCGATCGCCA...

CDS

Download CDS FASTA

666 bp · LXL04_001880|LXL04_001880|OH1004|CDS

ATGGCTGCTTCTATCAGTACCAGTCAACTAGGGTCTGCTTTTTTGGGCGAGCGGAATGGAATCTGCGTTTCAAGCGTTCCCGTCAGTCACCTCAGCTTCAGACGCAAAACAATCGAATGTAAAGAATCAAGAATCGGAAAACAACCAATCGAAGTCCCATCAAACGTAGTAATCACACTCGAAGGCCAAGATATGAAAGTAAAAGGTCCATTAGGCGAACTCGCACTTTCCTACCCACGAGAAATCGCAATCGATCGCCA...

Protein

Download Protein FASTA

221 aa · LXL04_001880|LXL04_001880|OH1004|PROTEIN

MAASISTSQLGSAFLGERNGICVSSVPVSHLSFRRKTIECKESRIGKQPIEVPSNVVITLEGQDMKVKGPLGELALSYPREIAIDRQDSILKISKAVETRRANQMHGLFRTLTSNMVVGVSKGFEKKLILVGVGYRAIVEGKELILSLGFSHPVKMTIPDDLKVKVEENTRITVSGYNKSNIGQFAATIRKWRPPEPYKGKGVKYADEIVRRKEGKAGKKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001880`
TK1151 ID	TkA01G502280
OH-1004 ID	LXL04_001880
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001880

Location Chr01:35866303-35867782 (-)

Description Similar to RPL6: 50S ribosomal protein L6, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05190`	This protein binds directly to 23S ribosomal RNA and is located at the aminoacyl-tRNA binding site of the peptidyltransferase center.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001880 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0006412 translation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

KEGG gene cross-reference

amr:AM1_4710

ath:AT1G05190

cyt:cce_4029

ter:Tery_2998

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.856

Rank 1 · LXL04_001880 · OH-1004

Mitochondrion0.190

Rank 2 · LXL04_001880 · OH-1004

Cytoplasm0.022

Rank 3 · LXL04_001880 · OH-1004

Nucleus0.013

Rank 4 · LXL04_001880 · OH-1004

Peroxisome0.006

Rank 5 · LXL04_001880 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00347.29Ribosomal_L652-123 aa

PF00347.29Ribosomal_L6131-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001880	`PF00347.29`	Ribosomal_L6	52	123	1.4e-37	129.1
LXL04_001880	`PF00347.29`	Ribosomal_L6	131	205	1.4e-37	129.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23049`	Arabidopsis thaliana	Large ribosomal subunit protein uL6c	78.027%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card