LXL04_001865 | RubberDandelionOmics

Gene overview

LXL04_001865

Reference: OH-1004 Chr: Chr01 Coordinates: 35335945-35348494 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5604 bp · LXL04_001865|LXL04_001865|OH1004|cDNA

ATGCAATCGGAACCAACTCCACACAAAGCCCTGCATCCAAGAAAACCTCCGGATCCAAACATCCAGAACACGAATTCATTACCCAAACCTGCCATGATTCAACGAAAAAGAAGATCATCAAGTCCAAACGGCCGCGATATAAGATCTGAAAATACCGCAAAACTAGCTCGTAATTCTGCAATTAAAGGTACGCAAAACATCACAGCATCCCTAATTGACAAACTAGATCCACGAGGACTCCTCAAACCTACTGAACCGAA...

CDS

Download CDS FASTA

5604 bp · LXL04_001865|LXL04_001865|OH1004|CDS

ATGCAATCGGAACCAACTCCACACAAAGCCCTGCATCCAAGAAAACCTCCGGATCCAAACATCCAGAACACGAATTCATTACCCAAACCTGCCATGATTCAACGAAAAAGAAGATCATCAAGTCCAAACGGCCGCGATATAAGATCTGAAAATACCGCAAAACTAGCTCGTAATTCTGCAATTAAAGGTACGCAAAACATCACAGCATCCCTAATTGACAAACTAGATCCACGAGGACTCCTCAAACCTACTGAACCGAA...

Protein

Download Protein FASTA

1867 aa · LXL04_001865|LXL04_001865|OH1004|PROTEIN

MQSEPTPHKALHPRKPPDPNIQNTNSLPKPAMIQRKRRSSSPNGRDIRSENTAKLARNSAIKGTQNITASLIDKLDPRGLLKPTEPNTPTQDNTLLMNQTNQNTDTRISHDMNLDNQIPTIQPINNTTLEDMNTNTNTANYDTWFAFDHAKSLHTGNLRSKAKLQYFPPTNIEDNQSPVIIPIQLCEQANEKHANTLFGYFIGANPSFTTVRDHVKSKWAPCGITDIKRNGKGFYLFKFSTEQGMMNVLQSDHWMIKDVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001865`
TK1151 ID	TkA02G523900
OH-1004 ID	LXL04_001865
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	30.800
Protein coverage (%)	TK1151 78.750 / OH-1004 50.455 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001865

Location Chr01:35335945-35348494 (-)

Description Similar to LINE-1 retrotransposable element ORF2 protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65750`	Putative ribonuclease H protein At1g65750.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001865 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0032197 retrotransposition Biological Process

GO:0090304 nucleic acid metabolic process Biological Process

GO:0003676 nucleic acid binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003824 catalytic activity Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function

GO:0009036 type II site-specific deoxyribonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · LXL04_001865 · OH-1004

Nucleus0.323

Rank 2 · LXL04_001865 · OH-1004

Cell membrane0.128

Rank 3 · LXL04_001865 · OH-1004

Mitochondrion0.048

Rank 4 · LXL04_001865 · OH-1004

Endoplasmic reticulum0.041

Rank 5 · LXL04_001865 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14111.13DUF4283190-273 aa

PF00078.33RVT_11287-1454 aa

PF13966.12zf-RVT1667-1751 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001865	`PF14111.13`	DUF4283	190	273	1.5e-16	60.6
LXL04_001865	`PF00078.33`	RVT_1	1287	1454	1.3e-16	61.8
LXL04_001865	`PF13966.12`	zf-RVT	1667	1751	3.7e-21	76.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C2F6`	Arabidopsis thaliana	Putative ribonuclease H protein At1g65750	34.061%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card